Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Universal primer of ribosome internal transcribed spacer of opisthorchidae trematode and design and amplification method

An internal transcribed spacer and universal primer technology, which can be used in biochemical equipment and methods, bioinformatics, and microbial determination/inspection, etc. Effects of defects identified by morphological features

Inactive Publication Date: 2020-02-04
HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, for one amplification, universal primers for multiple ITS segments can be obtained, and there are still few studies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Universal primer of ribosome internal transcribed spacer of opisthorchidae trematode and design and amplification method
  • Universal primer of ribosome internal transcribed spacer of opisthorchidae trematode and design and amplification method
  • Universal primer of ribosome internal transcribed spacer of opisthorchidae trematode and design and amplification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] A kind of fluke ribosomal transcribed spacer (ITS) general primer design method of Osteorchidaceae comprises the following steps:

[0024] 1) Obtain the 18S rDNA and 28S rDNA sequences of Opisthorchiae trematodes from Genbank, use Clusta1Xvl.8 for sequence alignment, and search for conserved regions at the 5' and 3' ends, and candidate regions for the left and right primers;

[0025] 2) Using OLIGO v6 software to analyze the sequence of the candidate region, the selection conditions of the primer sequence are: the primer length is 21-34bp, the GC content is 40%-65%, and the annealing temperature is 50-55°C. Primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

Embodiment 2

[0027] Determination and analysis of ribosomal transcribed spacer (ITS) sequences of two flukes of the family Opisthorchiae, the method is as follows:

[0028] (1) Genomic DNA extraction: Genomic DNA of Clonorchis sinensis and Mesorchis orientalis was extracted with a genomic DNA kit, then dissolved in TE and stored at -20°C;

[0029] (2) Amplification of ITS: The reaction conditions are as follows: take 100ng template DNA, 0.5uL upstream primer with a concentration of 10umol / L, 0.5uL downstream primer with a concentration of 10umol / L, 2.5uL 10X ExTaq Buffer, and 2uL with a concentration of 10mmol / L dNTP, 0.2uL ExTaq polymerase mix, add double distilled water to 25uL. The amplification reaction was carried out on a PCR instrument: 95°C pre-denaturation for 5 minutes, followed by 95°C denaturation for 30 s, 50°C annealing for 40 s, 72°C extension for 1 min 50 s, 35 cycles, and finally 72°C extension for 7 min.

[0030] (3) Sequencing and demarcation: PCR products were subject...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a universal primer of a ribosome internal transcribed spacer of opisthorchidae trematode. A forward primer sequence is ACAATGACGGTTTCAGCGAGT (SEG ID No.1), and a reverse primer sequence is CACAAACAACCCGACTCCAAGG (SEQ ID No.2). The invention further discloses a design and amplification method and application of the universal primer. The universal primer is designed based on18S rDNA and 28S rDNA sequences conserved at two ends of the ribosome internal transcribed spacer (ITS), the obtained primer is extremely high in specificity, the evolution rate of the amplified ITS1and ITS2 is relatively fast, and significant difference exists among species; and the primer is applied to the amplification of clonorchis sinensis and metorchis orientalis of opisthorchidae trematode, the accuracy is high, the defect of morphological characteristic identification is overcome, and the problem of hybrid germplasm is solved.

Description

technical field [0001] The invention belongs to the field of animal molecular biology, and relates to a general primer and a method for designing and amplifying a transcriptional spacer in the ribosome of Opisthorchiae trematodes. Background technique [0002] Trematodes of the families Opistorchidae, Dimorphidae, Nanophyetidae and Echinostomatae are the most important zoonotic parasites. Clonorchis sinensis is the most important parasite in the family Opisthorchiidae. According to reports, the number of people infected with Clonorchis sinensis in my country is as high as 12.9 million. In addition to being able to infect humans, it can also parasitize in final hosts such as dogs, cats, and pigs. Therefore, clonorchiasis is a very important zoonotic parasitic disease. The life cycle of M. orientalis is similar to that of Clonorchis sinensis. Although M. orientalis mainly infects poultry, human infection has also been reported. Current reports show that: in the fish in the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888G16B30/10C12N15/11C12Q1/6869
CPCC12Q1/6888G16B30/10C12Q1/6869C12Q2531/113
Inventor 高俊峰邱阳元马晓晓果馨如常巧呈王春仁
Owner HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com