Method for editing x-chromosome multi-copy genes to realize animal sex control

An X-chromosome, multi-copy technology, applied in the field of genetic engineering, can solve the problems of high off-target rate and the effect of gender control needs to be further improved.

What is AI technical title?
AI technical title is built by PatSnap AI team. It summarizes the technical point description of the patent document.
An X-chromosome, multi-copy technology, applied in the field of genetic engineering, can solve the problems of high off-target rate and the effect of gender control needs to be further improved.

CN111549070BActive Publication Date: 2022-05-13SOUTH CHINA AGRI UNIV

1 Cites 0 Cited by

Image

Smart Image Click on the blue labels to locate them in the text.

Viewing Examples

Smart Image

Examples

Experimental program

Comparison scheme

Effect test

Embodiment 1

[0039] 1. Selection of mouse multi-copy gene target sites and design of corresponding sgRNA

[0040] The X staining of the mouse was deeply sequenced, and the repeated sequences with more than 50 copies were selected for use. Then, the CRISPR / Cas9 target sequence online design software was used to analyze the candidate sequence, and compared with the whole mouse genome sequence, the X-B and X-D sites with the lowest off-target efficiency were selected, and the corresponding sgRNA X-B and sgRNA X-D sequences were designed. The information is shown in Table 1-2 below.

[0041] Table 1 Multi-copy target loci on mouse X chromosome

[0042] target site name Sequence (5'-3' underline marked as PAM region) copy number X-B GCTTGGTTAGGGTGAGTGCT TGG (SEQ ID NO:1)

72 X-D TAAGTGCTGTGTGCTGCTAC TGG (SEQ ID NO:2)

99

[0043] Table 2 sgRNA sequence

[0044] sgRNA name target site Sequence (5'-3') sgRNA X-B X-B GCTTGGTTAGGGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to View More

PUM

Login to View More

Abstract

The invention discloses a method for gene editing of X chromosome multi-copy genes to realize animal sex control. By screening and selecting one or more multi-copy genes on the X chromosome of mammals as target sites, designing and synthesizing corresponding sgRNAs, and then By constructing a CRISPR / Cas9 expression system targeting multiple copies of the X chromosome to cut the X chromosome in mammalian sperm or fertilized eggs, the entire X chromosome can be inactivated, the X sperm can be killed, and the birth rate of male mammals can be improved. , or lethal XY embryos, increase the birth rate of female mammals. The method provided by the invention has high cutting efficiency of X chromosome, low off-target rate, and good sex control effect.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for realizing sex control of mammals through gene editing of X chromosome multi-copy genes. Background technique [0002] In order to meet different production needs, people are eager to obtain a large number of livestock and poultry of the required sex through sex control technology, and reduce the waste of raw materials. The gene editing technology is a technology for editing the genome of an organism, which can realize the knockout, insertion and replacement of a certain gene, which provides a new direction for the research of sex control technology. Using gene editing technology, a knockout line of sex-related genes can be established to study its role in sex differentiation and gonad development, and then the expression of sex-related genes can be enhanced or inhibited by inserting foreign genes to achieve the purpose of sex ratio shift . However, the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to View More

Application Information

Patent Timeline

13 May 2022

Publication

CN111549070B

IPC: C12N15/90; C12N15/85; A01K67/027

CPC: C12N15/907; C12N15/8509; A01K67/0276; A01K2267/03; A01K2227/105; A01K2217/075

Inventors: 吴珍芳; 李紫聪