Tiantan remocined vaccine virus of IFN-alpha receptor gene (B8R) deletion and application thereof

A vaccinia virus, gene deletion technology, applied in genetic engineering, plant genetic improvement, virus/phage and other directions, can solve the problems of inability to induce CTL response, inability to protect HIV-1 attack, etc., to improve safety and immunogenicity. Effect

Inactive Publication Date: 2005-01-05
NAT CENT FOR AIDSSTD CONTROL & PREVENTION CHINESE CENT FOR DISEASE CONTROL & PREVENTION
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies in orangutan models have shown that inactivated vaccines cannot protect against HIV-1 challenge and cannot induce CTL responses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tiantan remocined vaccine virus of IFN-alpha receptor gene (B8R) deletion and application thereof
  • Tiantan remocined vaccine virus of IFN-alpha receptor gene (B8R) deletion and application thereof
  • Tiantan remocined vaccine virus of IFN-alpha receptor gene (B8R) deletion and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1. Construction of transfer plasmid

[0038] 1. Construction of plasmid pBR-SK

[0039] 5’PBR322-SACI-FOR

[0040] G GAGCTC CGACCGATGCCCTTGAGAGCC

[0041] 3’PBR322-KPNI-RE

[0042] GG GGTACC AGGTGGCACTTTTCGGGGAAATG

[0043] The PCR amplified commercial plasmid pBR322 includes the sequence of all the functional elements, denoted as pBR.

[0044] reaction system

[0045] 10×Pyrobest Buffer 5μl

[0046] dNTPMisture (2.5mM each) 5μl

[0047] 3’PBR322-KPNI-RE(50μM) 0.5μl

[0048] 5’PBR322-SACI-FOR(50μM) 0.5μl

[0049] pBR322 0.5μl

[0050] Pyrobest DNA Polymerase(5U / ml) 0.5μl

[0051] ddH2O 38μl

[0052] The reaction conditions were 94°C for pre-denaturation for 2 minutes; 94°C for 30s, 68°C for 5 minutes, 35 cycles in total; 72°C for 7 minutes; 4°C.

[0053] Purification The KpnI and SacI of Dalian Biotech co-digest the PCR product pBR and run the gel for recovery.

[0054] The plasmid pBS-SK was co-...

Embodiment 3 8

[0106] Example 3 AIDS vaccine of Tiantan strain of recombinant vaccinia virus with B8R gene deletion and expression of HIV-1 antigen VTKgpeΔB8RlacZ (B8R gene deletion is replaced by lacZ, TK region is inserted into B' / C type CN54 strain HIV-1 gagpol env gene).

[0107] That is, VTKgpe (Tiantan strain recombinant vaccinia virus with the TK region inserted into the B' / C type CN54 strain HIV-1 gagpol env gene) and the transfer plasmid pSKB8RLacZ were co-transfected into CEF cells for homologous recombination, followed by blue and white selection, continuous single spot purification, The recombinant virus VTKgpeΔB8RlacZ with B8R gene deletion replaced by lacZ was identified. After VTKgpe infects 80% of the sliced ​​CEF cells with a viral amount of 0.1~0.01PFU / cell and adsorbs for 1~1.5h, the recombinant plasmid pSKB8RLacZ is transfected into CEF cells by lipofection technology (refer to the Lipofectin kit from INVITROGEN, USA). After 48 hours, the recombinant virus solution was harves...

Embodiment 4 8

[0109] Example 4 AIDS vaccine of Tiantan strain of recombinant vaccinia virus with B8R gene deletion and expression of HIV-1 antigen VTKgpeΔB8R (B8R gene deletion without lacZ selection marker, TK region inserted with B' / C type CN54 strain HIV-1 gagpol env gene) .

[0110] Then, VTKgpeΔB8RlacZ was used as the parent strain to co-transfect CEF cells with pSKB8RNeo for homologous recombination. After G418 pressure screening, blue-white screening, continuous single-spot purification, and identification, a recombinant virus VTKgpeΔB8R with B8R gene deletion and no lacZ selection marker was obtained. After infection with VTKgpeΔB8RlacZ with a viral amount of 0.1~0.01PFU / cell, 80% of the sliced ​​CEF cells were adsorbed for 1~1.5h, and then the recombinant plasmid pSKB8RNeo was transfected into CEF cells using liposome transfection technology (refer to the Lipofectin kit from INVITROGEN, USA). After 48 hours, the recombinant virus solution was harvested and passed down for three generat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an IFN-gama receptor gene (B8R) deleted attenuating carrier of Tiantan recombinant t vaccinia virus as well as a Tiantan recombinant t vaccinia virus AIDS vaccinum deleting IFN-gama receptor gene (B8R) and expressing various HIV-1 antigens, which is constructed based on this carrier, a Tiantan recombinant t vaccinia virus VTKgpe, recombinant t vaccinia virus VTKgpe CGMCC.No.1099 and another a hepatitis-B virus HBSAg antigen, and a hepatitis-B vaccinum of Tiantan recombinant t vaccinia virus of IL-2.

Description

Technical field [0001] The present invention relates to a recombinant vaccinia virus attenuated vector of Tiantan strain lacking IFN-γ receptor gene (B8R) and an IFN-γ receptor gene (B8R) constructed based on this vector to express various antigens (monovalent and multivalent) of HIV-1 ) Missing Tiantan strain recombinant vaccinia virus AIDS vaccine. The Tiantan strain recombinant vaccinia virus attenuated vector of the present invention can significantly reduce the virulence of the vaccinia virus vector, and can be used to construct a multivalent recombinant vaccinia virus expressing multiple antigens of the same pathogen and multiple antigens of different pathogens. The recombinant vaccinia virus AIDS vaccine of the present invention can induce high-level humoral and cellular immune responses against human immunodeficiency virus (HIV), and effectively improve the safety and immunogenicity of the recombinant vaccinia virus AIDS vaccine. Background technique [0002] The vaccine ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/285A61K39/295C12N7/01C12N15/11C12N15/39C12N15/863
Inventor邵一鸣黄薇刘颖
OwnerNAT CENT FOR AIDSSTD CONTROL & PREVENTION CHINESE CENT FOR DISEASE CONTROL & PREVENTION