Ribonucleotide tag nucleic acid detection
a nucleic acid and ribonucleotide technology, applied in the field of nucleic acid detection, can solve the problems of limited improvement potential, inability to easily multiplex, and inability to achieve true multiplexing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Flag-Tag For High Throughput SNP Genotyping
[0139]Amplicon containing a SNP in the human H19 gene was prepared for analysis. The target sequence was gtgaggagtgtggagtaggyGCCCAGGCATCGTGCagacagggcgacatcagc (SEQ ID NO:11) (lower case indicates sequences that anneal to the primers, “y” indicates SNP position, C or T). PCR was performed in a total volume of 20 μl, with 2 μl coming from the genomic DNA samples diluted to 10 ng / μl. The PCR amplifications contained the following components: 50 mM Tricine pH 7.5, 100 mM KOAc, 2.75 mM Mg(OAc)2, and 1.6% Storage Buffer, which in turn contained 50% v / v glycerol, 100 mM KCl, 0.1 mM EDTA, 20 mM Tris pH 8.0, 1 mM DTT, and 0.5% Tween 20. Also included in the PCR was 0.2 mM each 5-methyl-dCTP and dGTP, 0.4 mM dUTP, 0.18 mM rATP, 0.02 mM dATP, and 0.1 mM pyrophosphate. The nucleotide base mixture contained 90% rATP and 10% dATP. Enzymes used in the PCR amplifications were 0.02 U / μl Uracil-DNA Glycosylase (UNG) and 20 nM GLTDSE DNA polymerase. See, e.g....
example 2
Flag-Tag For High Throughput Screening For Infectious Agents
[0143]The application of flag-tag technology to infectious agent screening was tested using RNA transcripts encoding an HIV-derived sequence. Transcript for these experiments was generated by cloning the gag region from HIV strain HXB2 into an expression vector. After linearizing, transcript was made using T7 RNA polymerase. Transcript was then purified over a poly-dT column. The target sequence was catgcagggcctattgcaccaGGCCAGATGAGAGAACCAAGGGGaagtgacatagcaggaactactagtaccc ttcagga (SEQ ID NO:17) (primer sequences are in lower case).
[0144]RT-PCR using this transcript was performed in duplicate, with a total volume of 50 μl per reaction. Reactions were performed with and without 106 copies of transcript per reaction. The reactions contained the following components: 100 mM Tricine pH 7.3, 120 mM KOAc, 1 mM Mn(OAc)2, 0.2 mM dGTP, 0.4 mM dUTP, a mixture of rATP and dATP such that the total was 0.2 mM with either 80% or 90% being...
example 3
Detection of A / G Alleles of SNP R in NOS1—361
Allele-Specific PCR:
[0148]Ribo-PCR amplifications in 20 μl with 1 ng / μl of human genomic DNA, 0.4 μM each primer (Table 1), 0.15 mM sodium pyrophosphate, 100 mM Tricine / KOH at pH 7.3, 100 mM KCOO at pH 7.5, 3 mM Mg(COO)2, 0.2 mM each (rATP, dCTP, dGTP and dTTP) and 0.25 U / μl FP-1 DNA Polymerase (i.e., GLTDSE DNA Polymerase). The thermal cycling profile for the PCR was 4 min at 92° C. followed by 60 cycles of 15 s at 92° C., 4 min at 63° C. This was always concluded at 4° C. 5 μl of PCR was put into a 2% of agarose gel to control the PCR.
[0149]Table 1 provides sequences of the primers used in this example. The symbol * indicates a 2′-PO4 containing residue. The symbol (C) indicates a 2′OMe cytidine base. Underline sequence represents the Flag part of the primer and a single heptamer is bolded in the primer sequences.
TABLE 1PrimerSequenceForward 1 CCTAGAAACTAGAAACTAGAAACTCTGATGGCTCACCATTGAAAA* SEQ ID NO: 20Forward 2 CCTAAAAACTAAAAACTAAAAACT...
PUM
| Property | Measurement | Unit |
|---|---|---|
| pH | aaaaa | aaaaa |
| temperatures | aaaaa | aaaaa |
| temperatures | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More