Method for detecting single nucleotide polymorphisms
a single nucleotide polymorphism and polymorphism technology, applied in the field of single nucleotide polymorphism detection, can solve the problems of increasing analysis cost, prolonging the time of whole analysis, and complicating operation of chain length difference by electrophoresis, so as to achieve rapid and simple detection of single nucleotide polymorphism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
[0069]The separation and detection of wild-type 76 bp and mutant-type 79 bp in UGT1A1*6 region was performed in Example 1.
(AS-PCR Amplification)
[0070]Wild-type and mutant-type amplification products were obtained using AS-PCR conditions as described below.
(1) Reagent
[0071]AccuPrime Taq DNA Polymerase High Fidelity (from Invitorgen, Lot. 760816)[0072]10×AccuPrime PCR Buffer I[0073]AccuPrime Taq DNA Polymerase High Fidelity (5 U / μL) UGT1A1*6 primer (from Operon Biotechnologies)
Forward (wild-type) (10 pmol / μL):(SEQ ID NO: 1)5′-(cgcctcgttgtacatcagagcgg)-3′Forward (mutant-type) (10 pmol / μL):(SEQ ID NO: 2)5′-(ctgacgcctcgttgtacatcagagcga)-3′Reverse (10 pmol / μL):(SEQ ID NO: 3)5′-(cacatcctccctttggaatggca)-3″[0074]Nuclease-free Water (not DEPC-treated) (from Ambion, Lot. 0803015)[0075]UGT1A1 gene wild-type sequence-inserted plasmid (1×106 copies / μL)[0076]UGT1A1 gene mutant-type sequence-inserted plasmid (1×106 copies / μL)
(2) Preparation
[0077]One (1) μL of each UGT1A1 gene sequence-inserted pla...
reference example 1
[0098]The separation and detection of wild-type 271 bp and mutant-type 274 bp in UGT1A1*6 region were performed in Reference Example 1.
(AS-PCR Amplification)
[0099]Wild-type and mutant-type amplification products were obtained using the following AS-PCR conditions.
(1) Reagent
[0100]AccuPrime Taq DNA Polymerase High Fidelity (from Invitrogen, Lot. 760816)[0101]10×AccuPrime PCR Buffer I[0102]AccuPrime Taq DNA Polymerase High Fidelity (5 U / μL) UGT1A1*6 primer (from Operon Biotechnologies)
Forward (wild-type) (10 pmol / μL):(SEQ ID NO: 1)5′-(cgcctcgttgtacatcagagcgg)-3′Forward (mutant-type) (10 pmol / μL):(SEQ ID NO: 2)5′(ctgacgcctcgttgtacatcagagcga)-3′Reverse (10 pmol / μL):(SEQ ID NO: 4)5′-(gaaagggtccgtcagcatgac)-3″[0103]Nuclease-free Water (not DEPC-treated) (from Ambion, Lot. 0803015)[0104]UGT1A1 gene wild-type sequence-inserted plasmid (1×106 copies / μL)[0105]UGT1A1 gene mutant-type sequence-inserted plasmid (1×106 copies / μL)
(2) Preparation
[0106]One (1) μL of each UGT1A1 gene sequence-inserte...
reference example 2
[0139]The separation and detection of wild-type 76 bp and mutant-type 79 bp in UGT1A1*6 region were performed in Reference Example 2.
[0140]HPLC analysis was performed using anion exchange column 2 in the same way as Example 1, except that the salt added to eluent B was sodium chloride in place of guanidine hydrochloride.
[0141]The chromatograms obtained by separating and detecting wild-type 76 bp and mutant-type 79 bp in UGT1A1*6 region in Example 1 are shown in FIG. 1 (when anion exchange column 1 is used) and FIG. 2 (when anion exchange column 2 is used). The results of FIGS. 1 and 2 show that both columns could favorably separate and detect the wild-type 76 bp and mutant-type 79 bp in UGT1A1*6 region amplified by AS-PCR. Particularly, the use of anion exchange column 1 could almost completely separate and detect them in a short time.
[0142]The chromatograms obtained by separating and detecting wild-type 271 bp and mutant-type 274 bp in UGT1A1*6 region in Reference Example 1 are sho...
PUM
| Property | Measurement | Unit |
|---|---|---|
| pKa | aaaaa | aaaaa |
| particle diameter | aaaaa | aaaaa |
| particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More