Unlock instant, AI-driven research and patent intelligence for your innovation.

Rapid diagnosis kit for listeria monocytogenes gene based on loop-mediated isothermal amplification technology and detecting method thereof

A technology for rapid diagnosis of Listeria, applied in biochemical equipment and methods, measurement/inspection of microorganisms, etc., can solve problems such as the gene rapid diagnostic kit for detecting Listeria monocytogenes, and achieve color difference Significant, high verification rate, easy identification effect

Inactive Publication Date: 2008-11-19
GUANGZHOU HUAFENG BIOTECH
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology. The established loop-mediated isothermal amplification technology (LAMP) has many advantages, and there is no useful loop at present. Gene rapid diagnostic kit for detecting Listeria monocytogenes by mediated isothermal amplification technique

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The preparation of embodiment 1 kit

[0034] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0035] Outer primer F3: ACAAGACTTCACCAATCCA, as shown in SEQ ID NO: 1;

[0036] Outer primer B3: GTCTTTTAAGTGGAGTAAACCTT, as shown in SEQ ID NO: 2;

[0037]Internal primer FIP: TAAGTCTCTTTGCAATTGACCGACTTTTACGTG TACACAGAAAAGCG, as shown in SEQ ID NO: 3;

[0038] Internal primer BIP: CCTGTGCCAAAGCATTTTTACATTTTTTAGGCAAGTCATCTTGTTCG, as shown in SEQ ID NO: 4;

[0039] (2) Purchasing DNA polymerase: BstDNA polymerase is placed in the container.

[0040] (3) Preparation of reaction solution: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L potassium chloride, 12.5mmol / L ammonium sulfate, 10mmol / L magnesium sulfate, 0.125% by volume TritonX-100, 1mol / L betaine, 2 mol / L each of the inner primers FIP / BIP and 0.25 mol / L each of the outer primers F3 / B3 were placed in the container.

[0041] (4) Prepare sa...

Embodiment 2

[0052] The preparation of embodiment 2 kit

[0053] The formula of the reaction solution is: the reaction solution contains 1.8mmol / LdNTP, 20mmol / LTris-Cl, 10mmol / L potassium chloride, 10mmol / L ammonium sulfate, 8mmol / L magnesium sulfate, 0.1vol%TritonX-100, 0.8mol / L Betaine, 1.6 mol / L of inner primer FIP / BIP and 0.2 mol / L of outer primer F3 / B3.

[0054] The formula of the sample pretreatment liquid is: the sample pretreatment liquid contains 10 mmol / L Tris-HCl (pH 8.0), 1 mmol / L EDTA and 1 volume % Triton X-100.

[0055] Others are the same as embodiment 1.

Embodiment 3

[0056] Example 3 Application of Listeria monocytogenes Gene Rapid Diagnostic Kit

[0057] 1. Sample processing (template DNA extraction)

[0058] 1) Take 1ml of the overnight culture enrichment solution in an eppendorf tube, centrifuge at 1000rpm for 2 minutes, and remove the supernatant;

[0059] 2) Add 100 μl of sample pretreatment solution to the centrifuge tube, and mix evenly with the precipitated cells;

[0060] 3) After cooking in boiling water for 10 minutes, immediately place it on ice to cool for 10 minutes;

[0061] 4) Centrifuge at 10,000 rpm for 2 minutes, and use the supernatant as template DNA to be used.

[0062] 2. The reaction process of loop-mediated isothermal amplification technology

[0063] 1) Prepare a reaction system in a 200 μl reaction tube: 22 μl of reaction solution, 0.5 μl of Bst DNA polymerase (4U), 30 μl of stabilization solution, and 2.5 μl of template DNA.

[0064] 2) React the prepared reaction tube at a constant temperature of 64° C. for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a mononuclear hyperplasia Listeria monocytogenes gene quick diagnosis reagent box based on a loop-mediated isothermal amplification technology and a method for detecting the same. The reagent box consists of two pairs of primers, DNA polymerase, reaction liquid, sample pretreatment liquid, developing liquid and a positive contrast solution, and the six kinds of liquid are respectively contained in a container. The gene quick diagnosis reagent box adopts six segments and four primers, and can judge whether a target substance exists or not according to the fact whether amplification occurs or not, thereby having high specificity. Moreover, the reagent box has quickness, high efficiency and high sensitivity, and can carry out amplification reaction just at a constant temperature without adopting special reagent and equipment. In addition, the reagent box can realize simple identification; therefore, pyrophosphate radical ion separated out from dNTP is combined with Mg<2+> in a reaction solution so as to generate byproduct magnesium pyrophosphate precipitate which can be identified through unaided viewing; moreover, after the developing liquid is added, the remarkable positive and negative result color developing difference is more obvious and reliable.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a rapid diagnosis kit of Listeria monocytogenes gene based on a loop-mediated isothermal amplification technique and a detection method thereof. Background technique [0002] At present, there are many detection methods for Listeria monocytogenes, from the national standard (GB / T4789.7-2003) focusing on the isolation and identification of pathogenic microorganisms, morphological identification and automatic biochemical identification, to the immunological detection of specific proteins technology, nucleic acid probe, polymerase chain reaction (PCR) technology and other molecular biological detection methods [Food Safety Testing and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try to break through the traditional microbi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/04C12Q1/68
Inventor 石磊曹以诚杜正平陈洵谭慧媚赵长臣刘妙琴李心晖
Owner GUANGZHOU HUAFENG BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More