41results about How to "Significant difference in color rendering" patented technology

The invention provides a loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and a testing method thereof; the diagnostic kit consists of two pairs of primers, a DNA polymerase, a reaction solution, a sample pretreatment solution, a color developing agent and a positive control solution which are respectively put in containers; the gene rapid diagnostic kit applies six sections and four primers to judge whether a target substance exists according to whether amplification occurs, thus having high specificity. The gene rapid diagnostic kit is rapid and highly effective, has high sensitivity, only needs a constant temperature for amplification and requires no special agents or equipment. The gene rapid diagnostic kit conducts diagnosis conveniently: pyrophosphate groups released by dNTP are bonded with mg in the reaction solution to generate a sedimentary byproduct, i.e. magnesium pyrophosphate which can be observed and judged visually; after the color developing agent is added, the color for a positive result is significantly different from the color for a negative result, thus being more obvious and reliable.

The invention relates to an LAMP (Loop-mediated Isothermal Amplification) detection kit of pathogenic aeromonas hydrophila, having convenient use and rapid detection. The LAMP detection kit comprises a bacterium DNA extracting reagent and an LAMP reaction reagent, wherein the reaction reagent contains primers FIP with the sequence of GTTTCCCCCATCAGATCCGTGGTTTACGCCACCCAGTTTCTTG, BIP with the sequence of TCCGGCCTGTATACCTGTATCAGGTTAAACCAGGGTGTCATCGCT, F3 with the sequence of TGATGGCCACGAGACATCCA and B3 with the sequence of TGCTTGATCCCCTTGCTACT. The LAMP detection method of the pathogenic aeromonas hydrophila comprises the following steps of: (1) DNA (Deoxyribonucleic Acid) extraction; (2) LAMP amplification of the pathogenic aeromonas hydrophila; and (3) staining detection. The invention is suitable for detecting the pathogenic aeromonas hydrophila.

The invention discloses a primer group for NPT(Noctumal Penile Tumescence)II gene detection, which consists of an outer primer F3, an outer primer B3, an FIP (Forward Inner Primer) and a BIP (Backward Inner Primer); nucleotide sequences of the outer primer F3, the outer primer B3, the FIP and the BIP are respectively shown by SEQ (Sequence) ID (Identity) No. 1-4 or SEQ ID No. 5-9. The primer group has the beneficial effects that whether a target substance exists or not can be judged according to whether to amplify or not, and the specificity is high. The invention also discloses a reagent kitfor detecting a NPTII gene, which comprises two pairs of primers, i.e. an FIP / BIP and an outer primer F3 / B3, which takes the NPTII gene as a target gene and is designed based on a loop-mediated isothermal amplification technology. The reagent kit has the beneficial effects that the NPTII gene can be quickly detected, the amplification can be carried out only by one constant temperature, a specialreagent or equipment is not required, the detection cost is low, and moreover, the sensitivity and the specificity are high. Meanwhile, the invention also discloses a use method of the reagent kit.

The invention discloses a rapid diagnostic reagent kit of legionella pneumophilia genes based on a loop-mediated isothermal amplification technique and a detecting method thereof, wherein the reagent kit consists of two pairs of primers, DNA polymerase, a stable liquid, a reaction liquid, a sample pretreatment liquid, a color rendering liquid and a positive contrast liquid which are respectively placed in a container. The gene rapid diagnostic reagent kit can judge whether target substances exist or not by applying applies six sections and the four primers according amplification or non-amplification, and thereby has high specificity. The gene rapid diagnostic reagent kit has high speed, high efficiency and high sensitivity, only needs a constant temperature for amplification reaction without special reagents and equipment, and has low detection cost. The gene rapid diagnostic reagent kit has simple identification, can generate magnesium pyrophosphate deposits as a byproduct by combining pyrophosphate ions precipitated from dNTP and Mg<2> in a reaction solution, can identify the magnesium pyrophosphate deposits through visual study, and has remarkable color rendering difference of negative and positive results after the color rendering liquid is added, and is more marked and reliable.

The invention discloses a primer group for testing Roundup Ready transgenic soy bean EPSPS gene based on the loop-mediated isothermal amplification of DNA (LAMP), a rapid diagnosis kit and a testing method thereof. The kit comprises the primer group, Bst DNA polymerase, stabilizing solution, reacting solution, developing solution and positive control solution. The kit applies six sections and four primers, can judge whether the target substance is existent or not according to the amplification, so that the kit has a high specificity. The rapid diagnosis kit of the invention is rapid, efficient and sensitive; the amplification reaction can be realized only needing constant temperature without the special agent or equipment; the testing cost is low and the test process is simple. Pyrophosphate ions separated from the dNTP are combined with Mg<2> in the reaction solution to generate the byproduct, i.e. magnesium pyrophosphate deposition, which can be observed and appraised by viewing; and the developing differences of the negative and positive results are obviously by adding the developing solution, and the results are more obvious and reliable.