Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

41results about How to "Significant difference in color rendering" patented technology

Primer pairs, method and fast diagnostic kit for detecting red-spotted grouper nervous necrosis viruses

InactiveCN101591714AReduce background impactImprove specificityMaterial analysis by observing effect on chemical indicatorMicrobiological testing/measurementBiologyGrouper nervous necrosis virus
The invention discloses primer pairs, a detection method and a fast diagnostic kit for detecting red-spotted grouper nervous necrosis viruses. The primer pairs comprise the following four primers: an inner primer FIP, an inner primer BIP, an external primer F3 and an external primer B3. Both the primer pairs and the kit of the invention can detect the red-spotted grouper nervous necrosis viruses with high efficiency and high specificity, as well as are based on loop-mediated isothermal amplification technology, apply six segments, four primers and one constant temperature, complete an amplification reaction within 1 hour, and are low in detection cost, short in detection time, high in yield and specificity, obvious in negative and positive result color developing difference, high in verification rate, obvious and reliable in verification. The kit is provided with a set of optimized reverse transcription-loop-mediated isothermal amplification reaction system can be used for detecting red-spotted grouper nervous necrosis viruses at different stages in a fish culture process, avoids viral spread and prevalence, improves scientific management efficiency and has high practical value.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Rapid diagnosis reagent kit and detection method for pseudomonas aeruginosa gene

The invention discloses a rapid diagnosis kit and a detection method of genes of pseudomonas aeruginosa. The kit consists of two pairs of primers, DNA polymerase, a stabilizing solution, a reaction solution, a sample pre-treatment solution, a color development solution and a positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.
Owner:GUANGZHOU HUAFENG BIOTECH

Lamp detection kit and detection method of macrobrachium rosenbergii dicistronic virus

ActiveCN102277453AStrong specificityReduce background effects in amplification reactionsMicrobiological testing/measurementRNA extractionRiver prawn
The invention discloses an LAMP detection kit and an LAMP detection method for macrobrachium rosenbergii bicistronic virus, which belongs to the technical field of target DNA segments. The detection kit comprises an RNA extraction reagent and a reverse transcription (RT)-LAMP reaction reagent. The detection method comprises: 1) extracting RNA of macrobrachium rosenbergii; 2) performing the RT-LAMP amplification of the macrobrachium rosenbergii bicistronic virus; and 3) performing color developing detection. The detection kit has high specificity and sensitivity, the detection method is convenient, sensitive, accurate and quick, and thus, a foundation is laid for the prevention of syndrome in larvae of macrobrachium rosenbergii.
Owner:ZHEJIANG INST OF FRESH WATER FISHERIES

LAMP detection kit for macrobrachium rosenbergii nudivirus and detection method thereof

Provided are an LAMP (loop-mediated isothermal amplification) detection kit for macrobrachium rosenbergii nudivirus and a detection method thereof. The invention belongs to the technical field of DNA fragment detection. The LAMP detection kit comprises a viral DNA extraction reagent and an LAMP reaction reagent. The LAMP reaction reagent contains an LAMP amplification-used nucleic acid primer group for detecting the macrobrachium rosenbergii nudivirus. The primer group contains a primer of MRNuV-FIP, a primer of MRNuV-BIP, a primer of MRNuV-F3, a primer of MRNuV-B3, a primer of MRNuV-LF and a primer of MRNuV-LB. The kit of the invention is high in specificity and sensitivity. The LAMP detection method for macrobrachium rosenbergii nudivirus makes use of the kit, and is convenient, sensitive, accurate and rapid.
Owner:ZHEJIANG INST OF FRESH WATER FISHERIES

Mycobacterium tuberculosis gene rapid diagnostic kit based on loop-mediated isothermal amplification technology and detection method thereof

The invention provides a mycobacterium tuberculosis gene rapid diagnostic kit based on loop-mediated isothermal amplification technology and detection method thereof. The kit consists of the following materials: two pairs of primers, DNA polymerase, reaction solution, lysate 1, lysate 2, stabilizing solution, color developing solution and positive control solution which are respectively contained in vessels. The gene rapid diagnostic kit has six sections and four primers and can be used for determining whether a target substance exists according to amplification situations, thus having high specificity. The gene rapid diagnostic kit is rapid, efficient and highly sensitive, and amplification reaction only requires constant temperature without a special reagent and special equipment. The gene rapid diagnostic kit has convenient identification, pyrophosphoric acid ions separated from dNTP are bonded with Mg in the reaction solution to produce a by-product magnesium pyrophosphate precipitate which can be identified by visual inspection, and negative and positive results show significant difference in color development after the color developing solution is added, which is more obvious and reliable.
Owner:GUANGZHOU HUAFENG BIOTECH

Rapid diagnosis reagent kit and detection method for vibrio vulnficus gene

The invention discloses a rapid diagnosis kit and a detection method of genes of vibrio vulnificus. The kit consists of two pairs of primers, DNA polymerase, stabilizing solution, reaction solution, sample pre-treatment solution, color development solution and positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.
Owner:GUANGZHOU HUAFENG BIOTECH

Rapid diagnosis reagent kit and detection method for cholera vibrio gene

The invention discloses a rapid diagnosis kit and a detection method of genes of comma bacillus. The kit consists of two pairs of primers, DNA polymerase, stabilizing solution, reaction solution, sample pre-treatment solution, color development solution and positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.
Owner:GUANGZHOU HUAFENG BIOTECH

Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof

The present invention discloses a rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and a detecting method thereof. The diagnostic kit is composed of two pairs of primers, DNA polyase, a reaction solution, a sample pretreating solution, a developing solution and a masculine contrast solution which are respectively installed in a container. The rapid diagnostic kit for gene according to the invention can determine the existence of target substance according to whether amplification exists through applying six sections and four primers, and therefore has high specificity. The rapid diagnostic kit for gene according to the invention has the advantages of high speed, high activity, high sensitiveness, capacity for executing the amplification reaction with only one constant temperature, no requirement of specific agent or device, and low detecting cost. The determination of the rapid diagnostic kit for gene according to the invention is convenient. The pyrophosphoric acid group ions precipitated from the dNTP are combined with the Mg in the reaction solution. The subsidiary product of magnesium pyrophosphate precipitate is generated and can be observed and determined visually. Furthermore after the developing solution is added, the difference of developing color between the negative result and the positive result is remarkable, and is more evident and reliable.
Owner:GUANGZHOU HUAFENG BIOTECH

Rapid detection kit and detection method of Chinese softshell turtle artertivirus

The invention discloses a rapid detection kit and detection method of Chinese softshell turtle artertivirus.The rapid detection kit of Chinese softshell turtle artertivirus comprises virus RNA extraction reagent and reaction reagent, the reaction reagent comprises a nucleic acid primer group for detecting amplification of Chinese softshell turtle artertivirus, and the primer group comprises a primer TSAV-F3, a primer TSAV-B3, a primer TSAV-FIP and a primer TSAV-BIP.By means of the rapid detection kit, an optimized ring mediated isothermal amplification reaction system is established, qualitative detection of Chinese softshell turtle artertivirus is made to be easier, more convenient and more rapid, specificity is high, sensitivity is high, the kit is the first kit for detecting Chinese softshell turtle artertivirus, the blank that no method for detecting Chinese softshell turtle artertivirus exists is made up for, and quite high scientific research and economic value is achieved.
Owner:ZHEJIANG INST OF FRESH WATER FISHERIES

Primer group for detecting vibrio coralliilyticus by using LAMP, quick diagnosis kit and detecting method

InactiveCN101691613AStrong specificityReduce background effects in amplification reactionsMicrobiological testing/measurementMicroorganism based processesBiologyVibrio coralliilyticus
The invention provides a primer group for detecting vibrio coralliilyticus by using LAMP, a quick diagnosis kit and a detecting method. The primer group comprises an external primer pair and an internal primer pair, wherein the external primer pair is VCF3(TGGTTGCAGGTGACATCAC) and VCB3(TCTACTGGGCTGTACGTAGC); the internal primer pair is VCFIP(CATWGCGATCTCAGCGTTGTCTTTTGATCGCTAACCCAGAACACG) and VCBIP(TGGTTACGTTCCAGCTTCAGCTTTCAACCAGTAGGCGACCRAT); W equals to A and T; and R equals to A and G. The invention also discloses a quick diagnosis kit containing the primer group and a detecting method. The primer group, the quick diagnosis kit and the detecting method have the advantages of short detection time, strong specificity and high detection sensitivity.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Primer for detecting CAMV35S genes, relevant kit and detecting method

The invention discloses a primer for detecting CAMV35S genes, a relevant kit and a detecting method. The primer for detecting the CAMV35S genes comprises an outer primer F3, an outer primer B3, an inner primer FIP and an inner primer BIP, and the nucleotide sequences of the primer are respectively shown as SEQ ID NO.1-4. The primer can judge whether target matter exists or not according to amplification, and has high specificity. The kit in the invention can rapidly diagnose the CAMV35S genes, can amplify at only a constant temperature without special reagents or equipment, has low detection cost and is suitable for popularization and application.
Owner:GUANGZHOU HUAFENG BIOTECH

Primer group and kit for detecting Roundup Ready transgenic soybeans

The invention discloses a primer group and a kit for detecting Roundup Ready transgenic soybeans. The kit consists of the primer group, Bst deoxyribonucleic acid (DNA) polymerase, a stabilizing solution, a reaction solution, a developing solution and a positive control solution. In the kit, six segments and four primers are utilized; and the kit has high specificity according to the condition that whether the existence of target materials can be judged or not through amplification. The quick diagnostic kit provided by the invention has high speed, high efficiency and high sensitivity, can be subjected to an amplification reaction only by a constant temperature without the usage of special reagents and equipment, has low detection cost and is easy and convenient to identify; pyrophosphate ions precipitated from deoxyribonucleoside triphosphate (dNTP) is combined with Mg<2+> in the reaction solution; the produced byproduct, namely magnesium pyrophosphate is precipitated and can be observed and identified through naked eyes; and after the developing solution is added, the kit has obvious development differences of negative and positive results and is more obvious and reliable. A soybean endogenous gene lectin is used as an internal label, so that errors and false negatives caused by the extraction of nucleic acid are prevented; and real-time monitoring is performed, so that detection time is greatly reduced, and human power and material resources are saved.
Owner:GUANGZHOU HUAFENG BIOTECH

Visualized rapid detection kit for carp dropsy virus and detection method thereof

The invention discloses a visualized rapid detection kit for carp dropsy virus and a detection method thereof. The visualized rapid detection kit for the carp dropsy virus includes a virus DNA extraction reagent and a reaction reagent, the reaction reagent contains a nucleic acid primer set used for detecting amplification of the carp dropsy virus, and the primer set contains a primer CEV-F3, a primer CEV-B3, a primer CEV-BFIP, a primer CEV-BIP, a primer CEV-LpF and a primer CEV-LpB. The rapid detection kit establishes a set of optimized isothermal amplification reaction system, the qualitative detection of the carp dropsy virus is thus simpler, faster, high in specificity and high in sensitivity, and the kit is the first kit used for detecting the carp dropsy virus, the problem that there is no detection method for the carp dropsy virus is solved, and has high scientific and economic value.
Owner:ZHEJIANG INST OF FRESH WATER FISHERIES

Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof

The invention discloses a primer group for NPT(Noctumal Penile Tumescence)II gene detection, which consists of an outer primer F3, an outer primer B3, an FIP (Forward Inner Primer) and a BIP (Backward Inner Primer); nucleotide sequences of the outer primer F3, the outer primer B3, the FIP and the BIP are respectively shown by SEQ (Sequence) ID (Identity) No. 1-4 or SEQ ID No. 5-9. The primer group has the beneficial effects that whether a target substance exists or not can be judged according to whether to amplify or not, and the specificity is high. The invention also discloses a reagent kitfor detecting a NPTII gene, which comprises two pairs of primers, i.e. an FIP / BIP and an outer primer F3 / B3, which takes the NPTII gene as a target gene and is designed based on a loop-mediated isothermal amplification technology. The reagent kit has the beneficial effects that the NPTII gene can be quickly detected, the amplification can be carried out only by one constant temperature, a specialreagent or equipment is not required, the detection cost is low, and moreover, the sensitivity and the specificity are high. Meanwhile, the invention also discloses a use method of the reagent kit.
Owner:GUANGZHOU HUAFENG BIOTECH

Rapid diagnostic kit based on loop-mediated isothermal amplification technique for hepatitis A virus genes and detection method thereof

The invention discloses a rapid diagnostic kit based on a loop-mediated isothermal amplification technique for hepatitis A virus genes and a detection method thereof. The kit comprises two pairs of primers, Bst DNA polymerase, revertase, an RNase inhibitor, a stabilizing solution, a reaction solution, a chromogenic solution and a positive contrast solution, wherein the nucleotide sequences of thetwo pairs of primers are shown in SEQ ID NO: 1-4; and the eight solutions are respectively contained in containers. The kit and the detection method can detect the hepatitis A virus with high efficiency and high specificity, are based on the loop-mediated isothermal amplification technique, apply six segments, four primers and one constant temperature to complete an amplification reaction within less than one hour, and have the advantages of low detection cost, short time consumption, high yield, high specificity, significant chromogenic difference between a positive result and a negative result, high authentication rate, distinctness and reliability.
Owner:GUANGZHOU HUAFENG BIOTECH

Mycobacterium detection kit and application method thereof

The invention provides a mycobacterium detection kit. The mycobacterium detection kit comprises two pairs of primers, including inner primers FIP / BIP and F3 / B3, wherein the two pairs of primers take hsp65 genes of mycobacterium as target genes and are designed on the basis of a loop-mediated isothermal amplification technique. The mycobacterium detection kit disclosed by the invention is more comprehensive in detection efficiency and low in undetected rate.
Owner:GUANGZHOU HUAFENG BIOTECH

Rapid diagnosis kit for listeria monocytogenes gene based on loop-mediated isothermal amplification technology and detecting method thereof

The invention provides a mononuclear hyperplasia Listeria monocytogenes gene quick diagnosis reagent box based on a loop-mediated isothermal amplification technology and a method for detecting the same. The reagent box consists of two pairs of primers, DNA polymerase, reaction liquid, sample pretreatment liquid, developing liquid and a positive contrast solution, and the six kinds of liquid are respectively contained in a container. The gene quick diagnosis reagent box adopts six segments and four primers, and can judge whether a target substance exists or not according to the fact whether amplification occurs or not, thereby having high specificity. Moreover, the reagent box has quickness, high efficiency and high sensitivity, and can carry out amplification reaction just at a constant temperature without adopting special reagent and equipment. In addition, the reagent box can realize simple identification; therefore, pyrophosphate radical ion separated out from dNTP is combined with Mg<2+> in a reaction solution so as to generate byproduct magnesium pyrophosphate precipitate which can be identified through unaided viewing; moreover, after the developing liquid is added, the remarkable positive and negative result color developing difference is more obvious and reliable.
Owner:GUANGZHOU HUAFENG BIOTECH

Kit for detecting swill-cooked dirty oil and detection method of kit

The invention relates to a kit for detecting swill-cooked dirty oil. The kit comprises a detection primer solution prepared from an outer primer I, an outer primer II, an inner primer I and an inner primer II, a BstDNA polymerase with chain displacement activity, a 10*reaction buffer, a dNTPs solution, a positive DNA control sample and a negative DNA control sample. Meanwhile, the invention also discloses a detection method of the kit. The kit disclosed by the invention has the characteristics of high specificity, high speed, high efficiency and low detection cost, is simple and convenient to operate and is suitable for rapid field detection.
Owner:NORTHWEST UNIVERSITY FOR NATIONALITIES

Rapid diagnosis kit of enterocolitis yersinia genus gene based on loop-mediated isothermal amplification technique

The invention discloses a kit for quickly diagnosing Yersinia genes of enterocolitis and a detection method thereof. The kit consists of two pairs of primers, DNA polymerase, a stabilizing solution, a reaction liquid, a sample pre-treatment fluid, a colored solution and a positive control solution, wherein the seven solutions are placed in a container respectively. The kit for quickly diagnosing the genes applies six segments and four primers, and can judge whether a drone substance exists or not according to the fact whether amplification is performed, so as to have high specificity. The kit for quickly diagnosing the genes is quick and high-efficiency, has high sensitivity, can perform amplification reaction only with a constant temperature, and does not require a special reagent and special equipment, so as to have low detection cost. Moreover, the kit for quickly diagnosing the genes is simple and convenient in identification; pyrophosphate ions separated out from dNTP are combined with Mg<2+> in a reaction solution to produce by-products - magnesium pyrophosphate deposits which can be observed and identified by naked eyes; and the color development difference is more obvious and reliable due to negative and positive results after addition of the colored solution.
Owner:GUANGZHOU HUAFENG BIOTECH

Primer for detecting CAMV35S genes, relevant kit and detecting method

The invention discloses a primer for detecting CAMV35S genes, a relevant kit and a detecting method. The primer for detecting the CAMV35S genes comprises an outer primer F3, an outer primer B3, an inner primer FIP and an inner primer BIP, and the nucleotide sequences of the primer are respectively shown as SEQ ID NO.1-4. The primer can judge whether target matter exists or not according to amplification, and has high specificity. The kit in the invention can rapidly diagnose the CAMV35S genes, can amplify at only a constant temperature without special reagents or equipment, has low detection cost and is suitable for popularization and application.
Owner:GUANGZHOU HUAFENG BIOTECH

Macrobrachium rosenbergii microsporidia visualized quick detection kit and detection method thereof

PendingCN107058587AStrong specificityReduce background effects in amplification reactionsMicrobiological testing/measurementMicroorganism based processesMicrosporidiaDNA extraction
The invention discloses a macrobrachium rosenbergii microsporidia visualized quick detection kit and a detection method thereof. The macrobrachium rosenbergii microsporidia visualized quick detection kit comprises a microsporidia DNA extraction reagent and a reaction reagent, and the reaction reagent contains a nucleic acid primer set used for detecting macrobrachium rosenbergii microsporidia proliferation, wherein a primer group comprises a primer MrMSP-F3, a primer MrMSP-B3, a primer MrMSP-FIP, a primer MrMSP-BIP, a primer MrMSP-LpF and a primer MrMSP-LpB. According to the macrobrachium rosenbergii microsporidia visualized quick detection kit, a set of optimized quick proliferation reaction system is established, so that not only is macrobrachium rosenbergii microsporidia qualitative detection simpler and faster, high in specificity and high in sensitivity, but also the kit can be used for field detection, and has very high scientific study and economic value.
Owner:ZHEJIANG INST OF FRESH WATER FISHERIES

Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof

The invention discloses a rapid diagnostic reagent kit of legionella pneumophilia genes based on a loop-mediated isothermal amplification technique and a detecting method thereof, wherein the reagent kit consists of two pairs of primers, DNA polymerase, a stable liquid, a reaction liquid, a sample pretreatment liquid, a color rendering liquid and a positive contrast liquid which are respectively placed in a container. The gene rapid diagnostic reagent kit can judge whether target substances exist or not by applying applies six sections and the four primers according amplification or non-amplification, and thereby has high specificity. The gene rapid diagnostic reagent kit has high speed, high efficiency and high sensitivity, only needs a constant temperature for amplification reaction without special reagents and equipment, and has low detection cost. The gene rapid diagnostic reagent kit has simple identification, can generate magnesium pyrophosphate deposits as a byproduct by combining pyrophosphate ions precipitated from dNTP and Mg<2> in a reaction solution, can identify the magnesium pyrophosphate deposits through visual study, and has remarkable color rendering difference of negative and positive results after the color rendering liquid is added, and is more marked and reliable.
Owner:GUANGZHOU HUAFENG BIOTECH

Primer group for detecting Yersinia pestis, rapid diagnosis kit and detection method

The invention discloses a primer group for detecting Yersinia pestis, a rapid diagnosis kit and a detection method, wherein the primer group consists of the following four primers: an external primer F3, an external primer B3, an inner primer FIP and an inner primer BIP. The kit consists of the primer group, Bst DNA polymerase, sample pretreatment solution, stabilizing solution, reaction solution, colored solution and positive control solution, and the seven kinds of solutions are placed in a vessel. Both the primer group and the kit can detect the Yersinia pestis with high efficiency and high specificity, as well as are based on loop-mediated isothermal amplification technology, apply six segments, four primers and one constant temperature, complete an amplification reaction within 1 hour, and are low in detection cost, short in detection time, high in yield and specificity, obvious in negative and positive result color developing difference, high in verification rate, obvious and reliable in verification.
Owner:GUANGZHOU HUAFENG BIOTECH

Rapid diagnosis reagent kit and detection method for vibrio vulnficus gene

The invention discloses a rapid diagnosis kit and a detection method of genes of vibrio vulnificus. The kit consists of two pairs of primers, DNA polymerase, stabilizing solution, reaction solution, sample pre-treatment solution, color development solution and positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.
Owner:GUANGZHOU HUAFENG BIOTECH

Salmonella and shigella joint detection kit and detection method thereof

The invention relates to a salmonella and shigella joint detection kit and a detection method thereof. The kit of the invention comprises Bst DNA polymerase, buffer solution, dNTPs, betaine, magnesium sulfate, development solution, stabilizing solution and positive control; and the kit also comprises two pairs of primers, namely inner primers FIP / BIP and outer primers F3 / B3 which take salmonella AgfA genes and shigella ipaH genes as target genes and are designed based on loop-mediated thermostatic amplification technology. The salmonella and shigella detection kit has the advantages of more comprehensive detection effect, high specificity and low omission factor, and is suitable for quickly detecting salmonella and shigella in physical examination of food employees.
Owner:GUANGZHOU HUAFENG BIOTECH +1