41results about How to "Significant difference in color rendering" patented technology

The invention provides a mycobacterium tuberculosis gene rapid diagnostic kit based on loop-mediated isothermal amplification technology and detection method thereof. The kit consists of the following materials: two pairs of primers, DNA polymerase, reaction solution, lysate 1, lysate 2, stabilizing solution, color developing solution and positive control solution which are respectively contained in vessels. The gene rapid diagnostic kit has six sections and four primers and can be used for determining whether a target substance exists according to amplification situations, thus having high specificity. The gene rapid diagnostic kit is rapid, efficient and highly sensitive, and amplification reaction only requires constant temperature without a special reagent and special equipment. The gene rapid diagnostic kit has convenient identification, pyrophosphoric acid ions separated from dNTP are bonded with Mg in the reaction solution to produce a by-product magnesium pyrophosphate precipitate which can be identified by visual inspection, and negative and positive results show significant difference in color development after the color developing solution is added, which is more obvious and reliable.

The invention provides a loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and a testing method thereof; the diagnostic kit consists of two pairs of primers, a DNA polymerase, a reaction solution, a sample pretreatment solution, a color developing agent and a positive control solution which are respectively put in containers; the gene rapid diagnostic kit applies six sections and four primers to judge whether a target substance exists according to whether amplification occurs, thus having high specificity. The gene rapid diagnostic kit is rapid and highly effective, has high sensitivity, only needs a constant temperature for amplification and requires no special agents or equipment. The gene rapid diagnostic kit conducts diagnosis conveniently: pyrophosphate groups released by dNTP are bonded with mg in the reaction solution to generate a sedimentary byproduct, i.e. magnesium pyrophosphate which can be observed and judged visually; after the color developing agent is added, the color for a positive result is significantly different from the color for a negative result, thus being more obvious and reliable.

The invention discloses a rapid diagnostic kit based on a loop-mediated isothermal amplification technique for hepatitis A virus genes and a detection method thereof. The kit comprises two pairs of primers, Bst DNA polymerase, revertase, an RNase inhibitor, a stabilizing solution, a reaction solution, a chromogenic solution and a positive contrast solution, wherein the nucleotide sequences of thetwo pairs of primers are shown in SEQ ID NO: 1-4; and the eight solutions are respectively contained in containers. The kit and the detection method can detect the hepatitis A virus with high efficiency and high specificity, are based on the loop-mediated isothermal amplification technique, apply six segments, four primers and one constant temperature to complete an amplification reaction within less than one hour, and have the advantages of low detection cost, short time consumption, high yield, high specificity, significant chromogenic difference between a positive result and a negative result, high authentication rate, distinctness and reliability.

The invention provides a mycobacterium detection kit. The mycobacterium detection kit comprises two pairs of primers, including inner primers FIP / BIP and F3 / B3, wherein the two pairs of primers take hsp65 genes of mycobacterium as target genes and are designed on the basis of a loop-mediated isothermal amplification technique. The mycobacterium detection kit disclosed by the invention is more comprehensive in detection efficiency and low in undetected rate.

The invention discloses a primer for detecting CAMV35S genes, a relevant kit and a detecting method. The primer for detecting the CAMV35S genes comprises an outer primer F3, an outer primer B3, an inner primer FIP and an inner primer BIP, and the nucleotide sequences of the primer are respectively shown as SEQ ID NO.1-4. The primer can judge whether target matter exists or not according to amplification, and has high specificity. The kit in the invention can rapidly diagnose the CAMV35S genes, can amplify at only a constant temperature without special reagents or equipment, has low detection cost and is suitable for popularization and application.

The invention relates to an LAMP (Loop-mediated Isothermal Amplification) detection kit of pathogenic aeromonas hydrophila, having convenient use and rapid detection. The LAMP detection kit comprises a bacterium DNA extracting reagent and an LAMP reaction reagent, wherein the reaction reagent contains primers FIP with the sequence of GTTTCCCCCATCAGATCCGTGGTTTACGCCACCCAGTTTCTTG, BIP with the sequence of TCCGGCCTGTATACCTGTATCAGGTTAAACCAGGGTGTCATCGCT, F3 with the sequence of TGATGGCCACGAGACATCCA and B3 with the sequence of TGCTTGATCCCCTTGCTACT. The LAMP detection method of the pathogenic aeromonas hydrophila comprises the following steps of: (1) DNA (Deoxyribonucleic Acid) extraction; (2) LAMP amplification of the pathogenic aeromonas hydrophila; and (3) staining detection. The invention is suitable for detecting the pathogenic aeromonas hydrophila.

The invention discloses a primer group for NPT(Noctumal Penile Tumescence)II gene detection, which consists of an outer primer F3, an outer primer B3, an FIP (Forward Inner Primer) and a BIP (Backward Inner Primer); nucleotide sequences of the outer primer F3, the outer primer B3, the FIP and the BIP are respectively shown by SEQ (Sequence) ID (Identity) No. 1-4 or SEQ ID No. 5-9. The primer group has the beneficial effects that whether a target substance exists or not can be judged according to whether to amplify or not, and the specificity is high. The invention also discloses a reagent kitfor detecting a NPTII gene, which comprises two pairs of primers, i.e. an FIP / BIP and an outer primer F3 / B3, which takes the NPTII gene as a target gene and is designed based on a loop-mediated isothermal amplification technology. The reagent kit has the beneficial effects that the NPTII gene can be quickly detected, the amplification can be carried out only by one constant temperature, a specialreagent or equipment is not required, the detection cost is low, and moreover, the sensitivity and the specificity are high. Meanwhile, the invention also discloses a use method of the reagent kit.

The invention discloses a rapid diagnostic reagent kit of legionella pneumophilia genes based on a loop-mediated isothermal amplification technique and a detecting method thereof, wherein the reagent kit consists of two pairs of primers, DNA polymerase, a stable liquid, a reaction liquid, a sample pretreatment liquid, a color rendering liquid and a positive contrast liquid which are respectively placed in a container. The gene rapid diagnostic reagent kit can judge whether target substances exist or not by applying applies six sections and the four primers according amplification or non-amplification, and thereby has high specificity. The gene rapid diagnostic reagent kit has high speed, high efficiency and high sensitivity, only needs a constant temperature for amplification reaction without special reagents and equipment, and has low detection cost. The gene rapid diagnostic reagent kit has simple identification, can generate magnesium pyrophosphate deposits as a byproduct by combining pyrophosphate ions precipitated from dNTP and Mg<2> in a reaction solution, can identify the magnesium pyrophosphate deposits through visual study, and has remarkable color rendering difference of negative and positive results after the color rendering liquid is added, and is more marked and reliable.

The invention discloses a primer group for testing Roundup Ready transgenic soy bean EPSPS gene based on the loop-mediated isothermal amplification of DNA (LAMP), a rapid diagnosis kit and a testing method thereof. The kit comprises the primer group, Bst DNA polymerase, stabilizing solution, reacting solution, developing solution and positive control solution. The kit applies six sections and four primers, can judge whether the target substance is existent or not according to the amplification, so that the kit has a high specificity. The rapid diagnosis kit of the invention is rapid, efficient and sensitive; the amplification reaction can be realized only needing constant temperature without the special agent or equipment; the testing cost is low and the test process is simple. Pyrophosphate ions separated from the dNTP are combined with Mg<2> in the reaction solution to generate the byproduct, i.e. magnesium pyrophosphate deposition, which can be observed and appraised by viewing; and the developing differences of the negative and positive results are obviously by adding the developing solution, and the results are more obvious and reliable.

The invention discloses a rapid diagnosis kit and a detection method of genes of vibrio vulnificus. The kit consists of two pairs of primers, DNA polymerase, stabilizing solution, reaction solution, sample pre-treatment solution, color development solution and positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.

The invention relates to a salmonella and shigella joint detection kit and a detection method thereof. The kit of the invention comprises Bst DNA polymerase, buffer solution, dNTPs, betaine, magnesium sulfate, development solution, stabilizing solution and positive control; and the kit also comprises two pairs of primers, namely inner primers FIP / BIP and outer primers F3 / B3 which take salmonella AgfA genes and shigella ipaH genes as target genes and are designed based on loop-mediated thermostatic amplification technology. The salmonella and shigella detection kit has the advantages of more comprehensive detection effect, high specificity and low omission factor, and is suitable for quickly detecting salmonella and shigella in physical examination of food employees.