Unlock instant, AI-driven research and patent intelligence for your innovation.

Rapid diagnosis reagent kit and detection method for vibrio vulnficus gene

A technology for rapid diagnosis of Vibrio vulnificus, which is applied in the fields of biochemical equipment and methods, measurement/testing of microorganisms, and resistance to vector-borne diseases, etc. Achieve the effects of significant color difference, high specificity, and rapid amplification

Active Publication Date: 2009-04-08
GUANGZHOU HUAFENG BIOTECH
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology. The established loop-mediated isothermal amplification technology (loop-mediated isothermal amplification of DNA, LAMP) has many advantages. and there is currently no gene rapid diagnostic kit for detection of Vibrio vulnificus using loop-mediated isothermal amplification technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The preparation of embodiment 1 kit

[0035] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0036] Outer primer F3: TGAGAACGGTGACAAAACGG;

[0037] Outer primer B3: GAGCTTATCGCCTTCCCAAT;

[0038] Internal primer FIP: AGGCCCCAAACTTGGTTCCAATTTTTTGCGGGTGGTTCGGTTA;

[0039] Inner primer BIP:

[0040] AGCCGAGTRGCATCCGATCGTTTTGCTAAGTTCGCACCACACT;

[0041] (2) Purchase DNA polymerase: BstDNApolymerase (large fragment) and place it in a container.

[0042](3) Preparation of reaction solution: The formula of the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, 2 mol each of primers FIP / BIP and 0.25 mol each of outer primers F3 / B3 were prepared and placed in containers.

[0043] (4) Preparation of sample pretreatment solution: the formula of sample pretreatment solution was prepared by containing 20...

Embodiment 2

[0054] The preparation of embodiment 2 kit

[0055] The formula of the reaction solution is: each 1L reaction solution contains 1.6mmol dNTP, 20mmol Tris-HCl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, internal primer FIP / BIP each 1.6 mol and 0.2mol each of outer primer F3 / B3;

[0056] The formula of the sample pretreatment solution is: every 1L of the sample pretreatment solution contains 10mmol of Tris-HCl with pH8.0, 1mmol of EDTA and 10ml of Triton X-100.

[0057] The chromogenic solution is EvaGreen.

[0058] Others are the same as embodiment 1.

Embodiment 3

[0059] Application of Example 3 Vibrio vulnificus Gene Rapid Diagnostic Kit

[0060] 1. Sample processing (template DNA extraction)

[0061] (1) Take about 200ml of water samples (or sediment, ooze, etc.) using aseptic techniques, and if there are impurities, they can be left to settle or centrifuged at 1000r / min for 1min to remove large particles;

[0062] (2) Filter the precipitated or centrifuged sample (supernatant) through a filter membrane with a pore size of 0.22 μm to 0.45 μm, remove the filter membrane and place it in 15ml sterilized water to fully elute;

[0063] (3) Take 5ml of the eluted sample, centrifuge at 10000rpm for 2min, and obtain the bacterial cell precipitate;

[0064] (4) Add 100 μl sample pretreatment solution to the above-mentioned cell pellet and mix evenly, boil in boiling water for 10 minutes, immediately place on ice to cool for 10 minutes, centrifuge at 10,000 rpm for 2 minutes, and the supernatant is the sample template DNA.

[0065] 2. The rea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rapid diagnosis kit and a detection method of genes of vibrio vulnificus. The kit consists of two pairs of primers, DNA polymerase, stabilizing solution, reaction solution, sample pre-treatment solution, color development solution and positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a rapid diagnosis kit of Vibrio vulnificus gene and a detection method thereof. Background technique [0002] At present, there are many detection methods for Vibrio vulnificus, ranging from isolation and identification of pathogenic microorganisms, morphological identification and automatic biochemical identification, to immunological detection technology of specific proteins, nucleic acid probes, polymerase chain reaction (PCR) technology and other molecules. Biological detection methods [Food Safety Testing and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try to break through the traditional microbiological detection modes such as morphology and biochemical reactions, and do not need to separate microorganisms. Puri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04
CPCY02A50/30
Inventor 曹以诚李志勇杜正平陈洵谭惠媚易敏英
Owner GUANGZHOU HUAFENG BIOTECH