Rapid diagnosis reagent kit and detection method for vibrio vulnficus gene
A technology for rapid diagnosis of Vibrio vulnificus, which is applied in the fields of biochemical equipment and methods, measurement/testing of microorganisms, and resistance to vector-borne diseases, etc. Achieve the effects of significant color difference, high specificity, and rapid amplification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0034] The preparation of embodiment 1 kit
[0035] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0036] Outer primer F3: TGAGAACGGTGACAAAACGG;
[0037] Outer primer B3: GAGCTTATCGCCTTCCCAAT;
[0038] Internal primer FIP: AGGCCCCAAACTTGGTTCCAATTTTTTGCGGGTGGTTCGGTTA;
[0039] Inner primer BIP:
[0040] AGCCGAGTRGCATCCGATCGTTTTGCTAAGTTCGCACCACACT;
[0041] (2) Purchase DNA polymerase: BstDNApolymerase (large fragment) and place it in a container.
[0042](3) Preparation of reaction solution: The formula of the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, 2 mol each of primers FIP / BIP and 0.25 mol each of outer primers F3 / B3 were prepared and placed in containers.
[0043] (4) Preparation of sample pretreatment solution: the formula of sample pretreatment solution was prepared by containing 20...
Embodiment 2
[0054] The preparation of embodiment 2 kit
[0055] The formula of the reaction solution is: each 1L reaction solution contains 1.6mmol dNTP, 20mmol Tris-HCl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, internal primer FIP / BIP each 1.6 mol and 0.2mol each of outer primer F3 / B3;
[0056] The formula of the sample pretreatment solution is: every 1L of the sample pretreatment solution contains 10mmol of Tris-HCl with pH8.0, 1mmol of EDTA and 10ml of Triton X-100.
[0057] The chromogenic solution is EvaGreen.
[0058] Others are the same as embodiment 1.
Embodiment 3
[0059] Application of Example 3 Vibrio vulnificus Gene Rapid Diagnostic Kit
[0060] 1. Sample processing (template DNA extraction)
[0061] (1) Take about 200ml of water samples (or sediment, ooze, etc.) using aseptic techniques, and if there are impurities, they can be left to settle or centrifuged at 1000r / min for 1min to remove large particles;
[0062] (2) Filter the precipitated or centrifuged sample (supernatant) through a filter membrane with a pore size of 0.22 μm to 0.45 μm, remove the filter membrane and place it in 15ml sterilized water to fully elute;
[0063] (3) Take 5ml of the eluted sample, centrifuge at 10000rpm for 2min, and obtain the bacterial cell precipitate;
[0064] (4) Add 100 μl sample pretreatment solution to the above-mentioned cell pellet and mix evenly, boil in boiling water for 10 minutes, immediately place on ice to cool for 10 minutes, centrifuge at 10,000 rpm for 2 minutes, and the supernatant is the sample template DNA.
[0065] 2. The rea...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More