83results about How to "High verification rate" patented technology

The invention relates to a system using a biologic characteristic certification result of a human body to validate the identity of a mobile communication terminal carrier, comprising a control terminal with a biologic characteristic input device, a remote network, a mobile communication network and a positioning communication terminal with a biologic characteristic collection device; the system at least also comprises an application server and a characteristic ID certification server, wherein the application server, the characteristic ID certification server and the positioning communication terminal with the biologic characteristic collection device are arranged in a local network or are integrally connected by the remote network and the mobile communication network; and the positioning communication terminal with the biologic characteristic collection device is connected with the characteristic ID certification server by the mobile communication network. The determination method can validate the identity of a mobile communication terminal holder and has the characteristics of high verification rate and low error ratio. The invention is suitable for personnel supervision, allocation and use the application of mobile communication service, such as supervised and corrected objects, public security patrolman personnel, bank service, mobile customer service and the like, in community correction.

The invention provides a klebsiella pneumoniae detection kit. The klebsiella pneumoniae detection kit comprises two pairs of primers, i.e., an inner primer FIP / BIP and an outer primer F3 / B3, which use oppA gene of klebsiella pneumoniae as the target gene and is designed based on the loop-mediated constant-temperature amplification technology. The klebsiella pneumoniae detection kit has more comprehensive detection effect and low omission ratio.

A correlation value image is generated from an input image and a template image, and separated into a positive correlation value image and a negative correlation value image. The template image is separated into a positive template image and a negative template image. A plurality of positive-negative-separated correlation images are generated by combining the positive correlation value image and the negative correlation value image and the positive template image and the negative template image. A polar-coordinates-converted input image and a polar-coordinates-converted template image are employed as the input image and the template image, respectively.

The invention relates to a cholera toxin virulence gene detection kit and a detection method thereof. The kit of the invention contains three pairs of primers which are designed by using vibrio cholera ctxA gene as target gene on the basis of the loop-mediated isothermal amplification technology, namely inner primers FIP / BIP, outer primers F3 / B3 and ring primers LF / LB and also contains Bst DNA polymerases, reaction solution, sample pretreatment solution, coloring liquid, stabilizing solution and positive control. The method for detecting the cholera toxin virulence gene comprises the following steps: extracting bacterial DNA, performing the loop-mediated isothermal amplification of the cholera toxin virulence gene and coloring for detection. The kit of the invention has high amplificationefficiency, specificity and sensitivity, low omission ratio and obvious coloring effect and is suitable for the rapid detection of toxigenic vibrio cholera.

The invention discloses primer pairs, a detection method and a fast diagnostic kit for detecting red-spotted grouper nervous necrosis viruses. The primer pairs comprise the following four primers: an inner primer FIP, an inner primer BIP, an external primer F3 and an external primer B3. Both the primer pairs and the kit of the invention can detect the red-spotted grouper nervous necrosis viruses with high efficiency and high specificity, as well as are based on loop-mediated isothermal amplification technology, apply six segments, four primers and one constant temperature, complete an amplification reaction within 1 hour, and are low in detection cost, short in detection time, high in yield and specificity, obvious in negative and positive result color developing difference, high in verification rate, obvious and reliable in verification. The kit is provided with a set of optimized reverse transcription-loop-mediated isothermal amplification reaction system can be used for detecting red-spotted grouper nervous necrosis viruses at different stages in a fish culture process, avoids viral spread and prevalence, improves scientific management efficiency and has high practical value.

The invention provides a mycobacterium tuberculosis detection kit which comprises the following two pairs of primers: inner primers FIP / BIP and outer primers F3 / B3, wherein the two pairs of primer takes a gyrB gene of a mycobacterium tuberculosis composite group as a target gene and are designed on the basis of loop-mediated isothermal amplification (LAMP) technology. The mycobacterium tuberculosis detection kit has more comprehensive detection effect and low omission ratio.

The invention discloses a rapid diagnosis kit and a detection method of genes of pseudomonas aeruginosa. The kit consists of two pairs of primers, DNA polymerase, a stabilizing solution, a reaction solution, a sample pre-treatment solution, a color development solution and a positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.

The invention discloses an LAMP detection kit and an LAMP detection method for macrobrachium rosenbergii bicistronic virus, which belongs to the technical field of target DNA segments. The detection kit comprises an RNA extraction reagent and a reverse transcription (RT)-LAMP reaction reagent. The detection method comprises: 1) extracting RNA of macrobrachium rosenbergii; 2) performing the RT-LAMP amplification of the macrobrachium rosenbergii bicistronic virus; and 3) performing color developing detection. The detection kit has high specificity and sensitivity, the detection method is convenient, sensitive, accurate and quick, and thus, a foundation is laid for the prevention of syndrome in larvae of macrobrachium rosenbergii.

The invention provides an escherichia coli detection kit which comprises two pairs of primers designed by using fliC genes of the escherichia coli as target genes on the basis of a loop-mediated isothermal amplification (LAMP) technology: inner primers FIP / BIP and outer primers F3 / B3. The escherichia coli detection kit has the advantages of more comprehensive detection effect and low omission ratio.

The invention discloses a safe mode index outsourcing method and a safe mode index outsourcing system under a single malicious cloud server. The method comprises the steps as follows: step1, a user T calls a sub-program Rand for six times to obtain six random pairs; step 2, the user T splits a mode index which needs to calculate according to the random pairs returned by the sub-program Rand, and simultaneously, the user T selects a random value r and multiplies the index of the mode index by r to obtain a new mode index, and splits the new mode index; step 3, the user T requests a server U to separately calculate the values which needs to calculate after splitting; step 4, the user T multiplies a random value which is related to ua and which is remained by the T by a result which is related to the ua and which is returned by the server U, and multiplies the results for r times to obtain a verification result 1; and the user T multiplies a random value which is related to ura and which is remained by the T by a result which is related to the ura and which is returned by the server U to obtain a verification result 2; comparing the result 1 and the result 2, and judging that the server could accurately perform calculation if the result 1 and the result 2 are equal to each other.

Provided are an LAMP (loop-mediated isothermal amplification) detection kit for macrobrachium rosenbergii nudivirus and a detection method thereof. The invention belongs to the technical field of DNA fragment detection. The LAMP detection kit comprises a viral DNA extraction reagent and an LAMP reaction reagent. The LAMP reaction reagent contains an LAMP amplification-used nucleic acid primer group for detecting the macrobrachium rosenbergii nudivirus. The primer group contains a primer of MRNuV-FIP, a primer of MRNuV-BIP, a primer of MRNuV-F3, a primer of MRNuV-B3, a primer of MRNuV-LF and a primer of MRNuV-LB. The kit of the invention is high in specificity and sensitivity. The LAMP detection method for macrobrachium rosenbergii nudivirus makes use of the kit, and is convenient, sensitive, accurate and rapid.

The invention provides a mycobacterium tuberculosis gene rapid diagnostic kit based on loop-mediated isothermal amplification technology and detection method thereof. The kit consists of the following materials: two pairs of primers, DNA polymerase, reaction solution, lysate 1, lysate 2, stabilizing solution, color developing solution and positive control solution which are respectively contained in vessels. The gene rapid diagnostic kit has six sections and four primers and can be used for determining whether a target substance exists according to amplification situations, thus having high specificity. The gene rapid diagnostic kit is rapid, efficient and highly sensitive, and amplification reaction only requires constant temperature without a special reagent and special equipment. The gene rapid diagnostic kit has convenient identification, pyrophosphoric acid ions separated from dNTP are bonded with Mg in the reaction solution to produce a by-product magnesium pyrophosphate precipitate which can be identified by visual inspection, and negative and positive results show significant difference in color development after the color developing solution is added, which is more obvious and reliable.

The invention discloses a rapid diagnosis kit and a detection method of genes of vibrio vulnificus. The kit consists of two pairs of primers, DNA polymerase, stabilizing solution, reaction solution, sample pre-treatment solution, color development solution and positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.

The invention provides a chip version switching method, device and system. The switching method comprises that after that a flag bit of version information is accessed, whether the flag bit is vacant is determined; if it is determined that the flag bit is not vacant, version information in chip data is replaced according to the flag bit; after that a first part address bit of the chip data is accessed, a flag in the flag bit is modified into a version setting flag, or the version setting flag is written in the flag bit; and whether a second part address bit of the chip data is accessed is determined, and if it is determined that the second part address bit of the chip data is accessed, the version setting flag in the flag bit is erased. According to the chip version switching method, device and system, the chip version information can match the version information of imaging equipment by accessing the address bit in the chip data, the chip is suitable for different versions of imaging equipment, and the upgrade resistance is high.

The invention relates to the vision field of a computer and discloses a face authentication method and a face authentication device. The face authentication method comprises the steps of selecting N face poses and presetting corresponding a bilateral depth convolution nerve network mode to each face pose, wherein N is natural number; respectively determining the face poses of two images to be verified; according to determined face poses, selecting the corresponding bilateral depth convolution nerve network mode; discriminating two images to be verified by the selected bilateral depth convolution nerve network mode; confirming whether the faces in two images to be verified are the same or not according to recognition results. By the face authentication method and the face authentication device, a problem that the current method and the current device have low discrimination rate and inaccurate recognition caused due to difference of complicated environment and authenticated images is solved.

The invention provides a kit for detecting brucella. The kit comprises two pairs of primers, i.e., an inner primer FIP / BIP and an outer primer F3 / B3, which adopt an OMP25 gene of the brucella as the target gene and are designed on the basis of loop-mediated isothermal amplification technology. The kit provided by the invention has the advantages that the detecting effect is more comprehensive and the loss rate is low.

The invention provides a mulberry silkworm pebrine test kit. The mulberry silkworm pebrine (Nb) test kit comprises two pairs of primers which are designed by taking mulberry silkworm pebrine spores as target genes on the basis of a loop-mediated isothermal amplification (LAMP) technology, namely external primers F3 / B3 and internal primers FIP / BIP. The mulberry silkworm pebrine test kit has a more comprehensive detection effect and low omission rate and can replace the conventional microscope detection technologies.

The invention discloses a primer group for gonococci detection. The primer group is designed on the basis of a loop-mediated isothermal amplification technology by using a gonococci PorA gene as a target gene, the primer group comprises an outer primer F3, an outer primer B3, an inner primer FIP and an inner primer BIP, and the nucleotide sequences of the primers are respectively shown in SEQ ID: 2-5. The primer group disclosed by the invention is high in sensitivity and strong in specificity, and can meet the requirement for quick and accurate detection of gonococci. The invention further discloses a gonococci detection kit. The kit can be used for quickly detecting gonococci and has the advantages of short detection time, low cost, high accuracy and the like.

A fingerprint authentication device (1A) reads a fingerprint by sliding of a finger relative to a fingerprint detection section (4) that is arranged at the bottom section (22a) of a channel-shaped finger sliding unit (22). The shape of the finger sliding unit (22) is formed wider at the open top section thereof than at the bottom section (22a).

The invention discloses a microbiological detection technology, in particular to a kit for diagnostic detection of Brucella and a use method of the kit. The Brucella detection kit of the invention at least comprises two pairs of specific amplification primers. The invention has the principle that by utilizing the loop-mediated isothermal amplification reaction (LAMP reaction for short), Bst DNA polymerase and two pairs of specific inner and outer primers (inner primers FIP / BIP and outer primers F3 / B3) designed according to a target gene sequence specifically recognize six independent regions on the target sequence, start cyclic chain displacement reaction and start complementary chain synthesis in the target DNA region, so that on the same chain, a complementary sequence cyclically forms a stem-loop DNA mixture with a plurality of loops and a cauliflower structure.

The invention provides a brucella detection kit. The brucella detection kit comprises two pairs of primers, namely internal primers FIP / BIP and external primers F3 / B3 which take the OMP25 gene of brucella as a target gene and are designed based on loop-mediated isothermal amplification technology. The brucella detection kit has more comprehensive detection effect and low undetected rate.

The invention discloses a rapid diagnosis kit and a detection method of genes of comma bacillus. The kit consists of two pairs of primers, DNA polymerase, stabilizing solution, reaction solution, sample pre-treatment solution, color development solution and positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.

The invention provides a primer group for detecting avian Borna virus. The primer group comprises two pairs of primers, inner primers FIP / BIP and outer primers F3 / B3, designed by using an avian Borna virus matrix protein gene as a target gene, and based on a loop-mediated isothermal amplification technology. The invention also discloses a kit for detecting avian Borna virus and a usage method thereof. The technical scheme provided by the invention can efficiently, accurately detect avian Borna virus, can be widely used in the inspection and quarantine of source of such disease, and lays foundation for study on an animal model of pathogenic mechanism of the RNA virus in a host.

The present invention discloses a rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and a detecting method thereof. The diagnostic kit is composed of two pairs of primers, DNA polyase, a reaction solution, a sample pretreating solution, a developing solution and a masculine contrast solution which are respectively installed in a container. The rapid diagnostic kit for gene according to the invention can determine the existence of target substance according to whether amplification exists through applying six sections and four primers, and therefore has high specificity. The rapid diagnostic kit for gene according to the invention has the advantages of high speed, high activity, high sensitiveness, capacity for executing the amplification reaction with only one constant temperature, no requirement of specific agent or device, and low detecting cost. The determination of the rapid diagnostic kit for gene according to the invention is convenient. The pyrophosphoric acid group ions precipitated from the dNTP are combined with the Mg in the reaction solution. The subsidiary product of magnesium pyrophosphate precipitate is generated and can be observed and determined visually. Furthermore after the developing solution is added, the difference of developing color between the negative result and the positive result is remarkable, and is more evident and reliable.

The invention discloses a rapid detection kit and detection method of Chinese softshell turtle artertivirus.The rapid detection kit of Chinese softshell turtle artertivirus comprises virus RNA extraction reagent and reaction reagent, the reaction reagent comprises a nucleic acid primer group for detecting amplification of Chinese softshell turtle artertivirus, and the primer group comprises a primer TSAV-F3, a primer TSAV-B3, a primer TSAV-FIP and a primer TSAV-BIP.By means of the rapid detection kit, an optimized ring mediated isothermal amplification reaction system is established, qualitative detection of Chinese softshell turtle artertivirus is made to be easier, more convenient and more rapid, specificity is high, sensitivity is high, the kit is the first kit for detecting Chinese softshell turtle artertivirus, the blank that no method for detecting Chinese softshell turtle artertivirus exists is made up for, and quite high scientific research and economic value is achieved.

The invention provides a primer group for detecting vibrio coralliilyticus by using LAMP, a quick diagnosis kit and a detecting method. The primer group comprises an external primer pair and an internal primer pair, wherein the external primer pair is VCF3(TGGTTGCAGGTGACATCAC) and VCB3(TCTACTGGGCTGTACGTAGC); the internal primer pair is VCFIP(CATWGCGATCTCAGCGTTGTCTTTTGATCGCTAACCCAGAACACG) and VCBIP(TGGTTACGTTCCAGCTTCAGCTTTCAACCAGTAGGCGACCRAT); W equals to A and T; and R equals to A and G. The invention also discloses a quick diagnosis kit containing the primer group and a detecting method. The primer group, the quick diagnosis kit and the detecting method have the advantages of short detection time, strong specificity and high detection sensitivity.

The invention discloses an on-line monitoring method of primary side shunt electric stealing of a CT (current transformer) of a 10kV special variable metering device, particularly relates to a method for searching for and locking electricity stealers by analyzing data which is acquired by a metering automation system. The on-line monitoring method is mainly characterized in that users who match a condition are treated as electricity stealing suspects by comparing whether power factor angle lag deviant values of split phases of time points to be inspected relative to interval time points are in the range of 40-65 DEG or not; and the electricity stealing suspects who cause abnormal line loss are treated as the electricity stealers by analyzing the data of line loss inflection point. The method for monitoring electricity stealing behaviors has very high accuracy; and an application of the method surely can bring great convenience to prevention of the electric larceny operation of utility companies.

The invention discloses a primer for detecting CAMV35S genes, a relevant kit and a detecting method. The primer for detecting the CAMV35S genes comprises an outer primer F3, an outer primer B3, an inner primer FIP and an inner primer BIP, and the nucleotide sequences of the primer are respectively shown as SEQ ID NO.1-4. The primer can judge whether target matter exists or not according to amplification, and has high specificity. The kit in the invention can rapidly diagnose the CAMV35S genes, can amplify at only a constant temperature without special reagents or equipment, has low detection cost and is suitable for popularization and application.