Klebsiella pneumoniae detection kit and use method thereof
A Klebsiella and detection kit technology, applied in the field of biological detection reagents, can solve the problems of insufficient accuracy, cumbersomeness, and high cost of fluorescent probes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0150] The preparation of embodiment 1 kit
[0151] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0152] Outer primer F3(1): (SEQ ID NO 1)
[0153] TACGCCCCGGTCTGAC
[0154] Outer primer B3(1): (SEQ ID NO 2)
[0155] GCGCTTTTCACCCCCAAC
[0156] Internal primer FIP(1): (SEQ ID NO 3)
[0157] GGCGAGACCAGTCGTTGCCATTTTCGACGGCACGGCCATT
[0158] Internal primer BIP(1): (SEQ ID NO 4)
[0159] AACAGCCTCCCCCCTACGCGATTTTGTCCCTTTTGCCCGAGG.
[0160] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;
[0161] (3) Prepare the buffer: the buffer is 0.18mol / L Tris-HCl, 0.10mol / L KCl, 0.07mol / L (NH 4 ) 2 SO 4 , 15mmol / L MgSO 4 , prepared with 1 volume % TritonX-100, placed in the container;
[0162] (4) Prepare dNTPs: each nucleotide concentration is prepared at 10 mmol / L and placed in a container;
[0163] (5) Preparation of betaine: the concentration of betaine is prepared by 3mol / L and placed in ...
Embodiment 2
[0175] The preparation of embodiment 2 kit
[0176] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0177] Outer primer F3(2): (SEQ ID NO 1)
[0178] TACGCCCCGGTCTGAC
[0179] Outer primer B3(2): (SEQ ID NO 2)
[0180] GCGCTTTTCACCCCCAAC
[0181] Internal primer FIP(2): (SEQ ID NO 5)
[0182] GGCGAGACCAGTCGTTGCCACGACGGCACGGCCATT
[0183] Internal primer BIP(2): (SEQ ID NO 6)
[0184] AACAGCCTCCCCCCTACGCGAGTCCCTTTTGCCCGAGG.
[0185] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;
[0186] (3) Prepare the buffer: the buffer is 0.25mol / L Tris-HCl, 0.15mol / L KCl, 0.15mol / L (NH 4 ) 2 SO 4 , 30mmol / L MgSO 4 , prepared with 2 volume % TritonX-100, placed in the container;
[0187] (4) Prepare dNTPs: each nucleotide concentration is prepared according to 20mmol / L, and placed in a container;
[0188] (5) Preparation of betaine: the concentration of betaine is prepared by 6mol / L and placed i...
Embodiment 3
[0195] Embodiment 3 Preparation of kit
[0196] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0197] Outer primer F3(3): (SEQ ID NO 7)
[0198] GCCATTACAGCGCAGGAT
[0199] Outer primer B3(3): (SEQ ID NO 8)
[0200] TGCAGCGTGGTGTCGT
[0201] Internal primer FIP(3): (SEQ ID NO 9)
[0202] GGTAGCTCGCGTAGGGGGATTTTCGTCTGGAGCTGGCAACG
[0203] Internal primer BIP(3): (SEQ ID NO 10)
[0204]CATATCGCCAACGCCCGCGTTTTGCGCTTTTCACCCCCAAC.
[0205] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;
[0206] (3) Prepare the buffer: the buffer is 0.2mol / L Tris-HCl, 0.1mol / L KCl, 0.1mol / L (NH 4 ) 2 SO 4 , 20mmol / L MgSO 4 , prepared with 1 volume % TritonX-100, placed in the container;
[0207] (4) Prepare dNTPs: each nucleotide concentration is prepared at 10 mmol / L and placed in a container;
[0208] (5) Preparation of betaine: the concentration of betaine is prepared by 5mol / L and placed in a conta...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap