Check patentability & draft patents in minutes with Patsnap Eureka AI!

Klebsiella pneumoniae detection kit and use method thereof

A Klebsiella and detection kit technology, applied in the field of biological detection reagents, can solve the problems of insufficient accuracy, cumbersomeness, and high cost of fluorescent probes

Active Publication Date: 2010-11-24
GUANGZHOU HUAFENG BIOTECH
View PDF1 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The traditional Klebsiella pneumoniae detection method is far from meeting the requirements of modern detection due to its shortcomings such as long detection cycle, complicated procedures, and various reagents required.
The pathogenic nucleic acid detection technology represented by polymerase chain reaction (PCR) technology has some problems in practical application, such as ordinary polymerase chain reaction (PCR) technology requires special equipment, and there are easy cross-contamination and cumbersome operation process Shortcomings
Although the fluorescent real-time quantitative polymerase chain reaction (real time PCR) technology solves the problem of cross-contamination and simplifies the operation process, it requires more complicated quantitative determination instruments, so it is not suitable for on-site rapid detection
Moreover, the cost of fluorescent probes in real-time quantitative polymerase chain reaction PCR technology is relatively high, which increases the difficulty of popularization and application.
Immunological detection technology is fast, simple and low-cost, but requires high-quality and high-stability monoclonal antibodies. Otherwise, due to insufficient accuracy, it can only be used as an auxiliary detection method at present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Klebsiella pneumoniae detection kit and use method thereof
  • Klebsiella pneumoniae detection kit and use method thereof
  • Klebsiella pneumoniae detection kit and use method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0150] The preparation of embodiment 1 kit

[0151] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0152] Outer primer F3(1): (SEQ ID NO 1)

[0153] TACGCCCCGGTCTGAC

[0154] Outer primer B3(1): (SEQ ID NO 2)

[0155] GCGCTTTTCACCCCCAAC

[0156] Internal primer FIP(1): (SEQ ID NO 3)

[0157] GGCGAGACCAGTCGTTGCCATTTTCGACGGCACGGCCATT

[0158] Internal primer BIP(1): (SEQ ID NO 4)

[0159] AACAGCCTCCCCCCTACGCGATTTTGTCCCTTTTGCCCGAGG.

[0160] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;

[0161] (3) Prepare the buffer: the buffer is 0.18mol / L Tris-HCl, 0.10mol / L KCl, 0.07mol / L (NH 4 ) 2 SO 4 , 15mmol / L MgSO 4 , prepared with 1 volume % TritonX-100, placed in the container;

[0162] (4) Prepare dNTPs: each nucleotide concentration is prepared at 10 mmol / L and placed in a container;

[0163] (5) Preparation of betaine: the concentration of betaine is prepared by 3mol / L and placed in ...

Embodiment 2

[0175] The preparation of embodiment 2 kit

[0176] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0177] Outer primer F3(2): (SEQ ID NO 1)

[0178] TACGCCCCGGTCTGAC

[0179] Outer primer B3(2): (SEQ ID NO 2)

[0180] GCGCTTTTCACCCCCAAC

[0181] Internal primer FIP(2): (SEQ ID NO 5)

[0182] GGCGAGACCAGTCGTTGCCACGACGGCACGGCCATT

[0183] Internal primer BIP(2): (SEQ ID NO 6)

[0184] AACAGCCTCCCCCCTACGCGAGTCCCTTTTGCCCGAGG.

[0185] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;

[0186] (3) Prepare the buffer: the buffer is 0.25mol / L Tris-HCl, 0.15mol / L KCl, 0.15mol / L (NH 4 ) 2 SO 4 , 30mmol / L MgSO 4 , prepared with 2 volume % TritonX-100, placed in the container;

[0187] (4) Prepare dNTPs: each nucleotide concentration is prepared according to 20mmol / L, and placed in a container;

[0188] (5) Preparation of betaine: the concentration of betaine is prepared by 6mol / L and placed i...

Embodiment 3

[0195] Embodiment 3 Preparation of kit

[0196] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0197] Outer primer F3(3): (SEQ ID NO 7)

[0198] GCCATTACAGCGCAGGAT

[0199] Outer primer B3(3): (SEQ ID NO 8)

[0200] TGCAGCGTGGTGTCGT

[0201] Internal primer FIP(3): (SEQ ID NO 9)

[0202] GGTAGCTCGCGTAGGGGGATTTTCGTCTGGAGCTGGCAACG

[0203] Internal primer BIP(3): (SEQ ID NO 10)

[0204]CATATCGCCAACGCCCGCGTTTTGCGCTTTTCACCCCCAAC.

[0205] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;

[0206] (3) Prepare the buffer: the buffer is 0.2mol / L Tris-HCl, 0.1mol / L KCl, 0.1mol / L (NH 4 ) 2 SO 4 , 20mmol / L MgSO 4 , prepared with 1 volume % TritonX-100, placed in the container;

[0207] (4) Prepare dNTPs: each nucleotide concentration is prepared at 10 mmol / L and placed in a container;

[0208] (5) Preparation of betaine: the concentration of betaine is prepared by 5mol / L and placed in a conta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a klebsiella pneumoniae detection kit. The klebsiella pneumoniae detection kit comprises two pairs of primers, i.e., an inner primer FIP / BIP and an outer primer F3 / B3, which use oppA gene of klebsiella pneumoniae as the target gene and is designed based on the loop-mediated constant-temperature amplification technology. The klebsiella pneumoniae detection kit has more comprehensive detection effect and low omission ratio.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a detection kit for Klebsiella pneumoniae and a use method thereof. Background technique [0002] Klebsiella pneumoniae, belonging to the family Enterobacteriaceae, is a Gram-negative bacillus that does not require high nutrition and can grow on ordinary agar medium. The optimum growth temperature is 37°C. Klebsiella pneumoniae is highly pathogenic to humans and is one of the important opportunistic pathogens and iatrogenic infections. Klebsiella pneumoniae is widely distributed in nature such as soil, water, agricultural products and forest products , It is also common in the intestinal tract and respiratory tract of humans and animals. Food contaminated by Klebsiella pneumoniae has no difference in appearance and taste from normal food, so accurate and rapid detection of Klebsiella pneumoniae is of great significance. [0003] The traditional Klebsiella pneumoniae detection m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 曹以诚杜正平陈洵李志勇高东微田文武冯雪梅尹斌
Owner GUANGZHOU HUAFENG BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More