Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof

A technology for rapid diagnosis of Listeria, applied in the direction of microbe-based methods, biochemical equipment and methods, microbiological determination/inspection, etc., can solve the problem of unseen gene rapid diagnostic kits for detecting Listeria monocytogenes , to achieve significant color difference, high specificity, and rapid amplification

Active Publication Date: 2009-10-14
GUANGZHOU HUAFENG BIOTECH
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology. The established loop-mediated isothermal amplification technology (LAMP) has many advantages, and there is no useful loop at present. Gene rapid diagnostic kit for detecting Listeria monocytogenes by mediated isothermal amplification technique

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof
  • Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof
  • Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] The preparation of embodiment 1 kit

[0040] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0041] Outer primer F3: ACAAGACTTCACCAATCCA, as shown in SEQ ID NO: 1;

[0042] Outer primer B3: GTCTTTTAAGTGGAGTAAACCTT, as shown in SEQ ID NO: 2;

[0043] Internal primer FIP: TAAGTCTCTTTGCAATTGACCGACTTTTACGTGTACACAGAAAAAGCG, as shown in SEQ ID NO: 3;

[0044] Internal primer BIP: CCTGTGCCAAAGCATTTTTACATTTTTTAGGCAAGTCATCTTGTTCG, as shown in SEQ ID NO: 4;

[0045] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container.

[0046] (3) Preparation of reaction solution: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L potassium chloride, 12.5mmol / L ammonium sulfate, 10mmol / L magnesium sulfate, 0.125% by volume TritonX-100, 1mol / L betaine, 2 mol / L each of the inner primers FIP / BIP and 0.25 mol / L each of the outer primers F3 / B3 were placed in the container.

[0047] (4) Prepare ...

Embodiment 2

[0058] The preparation of embodiment 2 kit

[0059] The formula of the reaction solution is: the reaction solution contains 1.8mmol / LdNTP, 20mmol / LTris-Cl, 10mmol / L potassium chloride, 10mmol / L ammonium sulfate, 8mmol / L magnesium sulfate, 0.1vol%TritonX-100, 0.8mol / L Betaine, 1.6 mol / L of inner primer FIP / BIP and 0.2 mol / L of outer primer F3 / B3.

[0060] The formula of the sample pretreatment liquid is: the sample pretreatment liquid contains 10 mmol / L Tris-HCl (pH 8.0), 1 mmol / L EDTA and 1 volume % Triton X-100.

[0061] Others are the same as embodiment 1.

Embodiment 3

[0062] Example 3 Application of Listeria monocytogenes Gene Rapid Diagnostic Kit

[0063] 1 Materials and methods

[0064] 1.1 Materials

[0065] 1.1.1 Strains

[0066] There are 28 bacterial strains used by the company, mainly from the American Standard Biological Collection Center, clinical isolates and environmental isolates. See Table 1 for details.

[0067] Table 1 Names and sources of strains

[0068] strain source

Strain and serial number

American Standard Biological Collection

Center (ATCC)

Listeria monocytogenes (7466), Listeria innocuci (33090),

Listeria ovis (19119), Listeria wales (35897),

Listeria gasseri (25401);

Clinical isolates

Derived from 20 strains of Listeria monocytogenes in the test sample;

other strains

Salmonella, Escherichia coli O157, Staphylococcus aureus each 1 strain.

[0069] 1.1.2 Main instruments and reagents

[0070] 1.2 Identification of isolated strains

[0071] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and a testing method thereof; the diagnostic kit consists of two pairs of primers, a DNA polymerase, a reaction solution, a sample pretreatment solution, a color developing agent and a positive control solution which are respectively put in containers; the gene rapid diagnostic kit applies six sections and four primers to judge whether a target substance exists according to whether amplification occurs, thus having high specificity. The gene rapid diagnostic kit is rapid and highly effective, has high sensitivity, only needs a constant temperature for amplification and requires no special agents or equipment. The gene rapid diagnostic kit conducts diagnosis conveniently: pyrophosphate groups released by dNTP are bonded with mg in the reaction solution to generate a sedimentary byproduct, i.e. magnesium pyrophosphate which can be observed and judged visually; after the color developing agent is added, the color for a positive result is significantly different from the color for a negative result, thus being more obvious and reliable.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a rapid diagnosis kit of Listeria monocytogenes gene based on a loop-mediated isothermal amplification technique and a detection method thereof. Background technique [0002] At present, there are many detection methods for Listeria monocytogenes, from the national standard (GB / T4789.7-2003) focusing on the isolation and identification of pathogenic microorganisms, morphological identification and automatic biochemical identification, to the immunological detection of specific proteins technology, nucleic acid probe, polymerase chain reaction (PCR) technology and other molecular biological detection methods [Food Safety Testing and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try to break through the traditional microbi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12R1/01
Inventor曹以诚杜正平李志勇陈洵谭慧媚李心晖王志强高东微邓小玲柯昌文
OwnerGUANGZHOU HUAFENG BIOTECH