Escherichia coli detection kit and use method thereof
A detection kit, Escherichia coli technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as low specificity and easy occurrence of false positives
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0119] The preparation of embodiment 1 kit
[0120] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0121]Outer primer F3(1): (SEQ ID NO 1)
[0122] CAGGAGTTGCTTTTGCGA
[0123] Outer primer B3(1): (SEQ ID NO 2)
[0124] AAACGGATTCAGCAGGTA
[0125] Internal primer FIP(1): (SEQ ID NO 3)
[0126] GAAAGCGCTGCTCAAAGCAGttttTGTGCCATTGAATGTCAGA
[0127] Internal primer BIP(1): (SEQ ID NO 4)
[0128] CTGCGCTACCAGCGTTGTTAttttATATCACCATCGGTGGAAG.
[0129] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;
[0130] (3) Preparation of reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L KCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / L MgSO 4 , 0.125% by volume TritonX-100, 1mol / L betaine, 0.2 μmol / L each of the inner primer FIP / BIP and 2.0 μmol / L each of the outer primer F3 / B3, placed in the container;
[0131] (4) Preparation of sample pretreatment solut...
Embodiment 2
[0150] The preparation of embodiment 2 kit
[0151] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0152] Outer primer F3(2): (SEQ ID NO 5)
[0153] CTTTGAGCAGCGCTTTCA
[0154] Outer primer B3(2): (SEQ ID NO 6)
[0155] GGGTAAATCTGTTAATGGTTCTT
[0156] Internal primer FIP(2): (SEQ ID NO 7)
[0157] GCATACGTAGACGATGCAGGCttttCAGCTTTAGCTGCGCTAC
[0158] Internal primer BIP(2): (SEQ ID NO 8)
[0159] GGCTTCCACCGATGGTGATAttttACACCACAAAAGATGGTACTG.
[0160] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;
[0161] (3) Preparation of reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / L Tris-Cl, 10mmol / L KCl, 10mmol / L (NH 4 ) 2 SO 4 , 8mmol / L MgSO 4 , 0.1 volume % TritonX-100, 0.8 mol / L betaine, each 0.25 μmol / L of inner primer FIP / BIP and each 1.2 μmol / L of outer primer F3 / B3 are placed in the container;
[0162] (4) Preparation of sample pretreatment solut...
Embodiment 3
[0176] Application of Example 3 Escherichia coli Detection Kit
[0177] 1 Materials and methods
[0178] 1.1 Materials
[0179] 1.1.1 Strains
[0180] There are 28 bacterial strains used in the present invention, which are mainly derived from the Guangzhou Entry-Exit Inspection and Quarantine Bureau, clinical isolates and environmental isolates. See Table 1 for details.
[0181] Table 1 strain name and source
[0182] strain source
Strain and serial number
Guangzhou CIQ
Escherichia coli (H7B)
Clinical isolates
Derived from Escherichia coli H716 strain in the test sample;
[0183] other strains
Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Salmonella
Bacteria, Listeria monocytogenes, Yersinia enterocolitica
Bacteria and beta-hemolytic streptococcus each.
[0184] 1.1.2 Main instruments and reagents
[0185] 1.2 Identification of isolated strains
[0186] 1.2.1 Cultivation of Escheri...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com