Escherichia coli detection kit and use method thereof

A detection kit, Escherichia coli technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as low specificity and easy occurrence of false positives

Active Publication Date: 2011-01-12
GUANGZHOU HUAFENG BIOTECH
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the environment, Escherichia coli with O157 antigen instead of O157:H7 occupies a certain proportion, so false positives are prone to occur, and the specificity is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0119] The preparation of embodiment 1 kit

[0120] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0121]Outer primer F3(1): (SEQ ID NO 1)

[0122] CAGGAGTTGCTTTTGCGA

[0123] Outer primer B3(1): (SEQ ID NO 2)

[0124] AAACGGATTCAGCAGGTA

[0125] Internal primer FIP(1): (SEQ ID NO 3)

[0126] GAAAGCGCTGCTCAAAGCAGttttTGTGCCATTGAATGTCAGA

[0127] Internal primer BIP(1): (SEQ ID NO 4)

[0128] CTGCGCTACCAGCGTTGTTAttttATATCACCATCGGTGGAAG.

[0129] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;

[0130] (3) Preparation of reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L KCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / L MgSO 4 , 0.125% by volume TritonX-100, 1mol / L betaine, 0.2 μmol / L each of the inner primer FIP / BIP and 2.0 μmol / L each of the outer primer F3 / B3, placed in the container;

[0131] (4) Preparation of sample pretreatment solut...

Embodiment 2

[0150] The preparation of embodiment 2 kit

[0151] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0152] Outer primer F3(2): (SEQ ID NO 5)

[0153] CTTTGAGCAGCGCTTTCA

[0154] Outer primer B3(2): (SEQ ID NO 6)

[0155] GGGTAAATCTGTTAATGGTTCTT

[0156] Internal primer FIP(2): (SEQ ID NO 7)

[0157] GCATACGTAGACGATGCAGGCttttCAGCTTTAGCTGCGCTAC

[0158] Internal primer BIP(2): (SEQ ID NO 8)

[0159] GGCTTCCACCGATGGTGATAttttACACCACAAAAGATGGTACTG.

[0160] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;

[0161] (3) Preparation of reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / L Tris-Cl, 10mmol / L KCl, 10mmol / L (NH 4 ) 2 SO 4 , 8mmol / L MgSO 4 , 0.1 volume % TritonX-100, 0.8 mol / L betaine, each 0.25 μmol / L of inner primer FIP / BIP and each 1.2 μmol / L of outer primer F3 / B3 are placed in the container;

[0162] (4) Preparation of sample pretreatment solut...

Embodiment 3

[0176] Application of Example 3 Escherichia coli Detection Kit

[0177] 1 Materials and methods

[0178] 1.1 Materials

[0179] 1.1.1 Strains

[0180] There are 28 bacterial strains used in the present invention, which are mainly derived from the Guangzhou Entry-Exit Inspection and Quarantine Bureau, clinical isolates and environmental isolates. See Table 1 for details.

[0181] Table 1 strain name and source

[0182] strain source

Strain and serial number

Guangzhou CIQ

Escherichia coli (H7B)

Clinical isolates

Derived from Escherichia coli H716 strain in the test sample;

[0183] other strains

Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Salmonella

Bacteria, Listeria monocytogenes, Yersinia enterocolitica

Bacteria and beta-hemolytic streptococcus each.

[0184] 1.1.2 Main instruments and reagents

[0185] 1.2 Identification of isolated strains

[0186] 1.2.1 Cultivation of Escheri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an escherichia coli detection kit which comprises two pairs of primers designed by using fliC genes of the escherichia coli as target genes on the basis of a loop-mediated isothermal amplification (LAMP) technology: inner primers FIP/BIP and outer primers F3/B3. The escherichia coli detection kit has the advantages of more comprehensive detection effect and low omission ratio.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to an Escherichia coli detection kit and a use method thereof. Background technique [0002] H7 E. coli is a subtype of the hundreds of species of E. coli. While the vast majority of bacteria that grow in the guts of healthy humans and animals are harmless, this one produces a potent toxin that can cause serious disease. Therefore, it is very important to detect H7 Escherichia coli accurately and rapidly. [0003] The traditional E. coli detection method is far from meeting the requirements of modern detection due to its shortcomings such as long detection cycle, complicated procedures, and various reagents required. The pathogenic nucleic acid detection technology represented by polymerase chain reaction (PCR) technology has some problems in practical application, such as ordinary polymerase chain reaction (PCR) technology requires special equipment, and there are easy cross-cont...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/10
Inventor 曹以诚杜正平陈洵谭慧媚冯雪梅尹斌柯佳佳
Owner GUANGZHOU HUAFENG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap