Unlock instant, AI-driven research and patent intelligence for your innovation.

Mycobacterium tuberculosis gene rapid diagnostic kit based on loop-mediated isothermal amplification technology and detection method thereof

A technology for rapid diagnosis of Mycobacterium tuberculosis, which is applied in the directions of microorganism-based methods, biochemical equipment and methods, and determination/examination of microorganisms. The effect of significant color difference, high yield and low detection cost

Active Publication Date: 2009-11-04
GUANGZHOU HUAFENG BIOTECH
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology. The established loop-mediated isothermal amplification technology (LAMP) has many advantages, and there is no useful loop at present. Gene rapid diagnostic kit for detection of Mycobacterium tuberculosis by mediated isothermal amplification technique

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycobacterium tuberculosis gene rapid diagnostic kit based on loop-mediated isothermal amplification technology and detection method thereof
  • Mycobacterium tuberculosis gene rapid diagnostic kit based on loop-mediated isothermal amplification technology and detection method thereof
  • Mycobacterium tuberculosis gene rapid diagnostic kit based on loop-mediated isothermal amplification technology and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The preparation of embodiment 1 kit

[0041] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0042] Outer primer F3: GGCTGGTCTCTGGCGTT, as shown in SEQ ID NO: 1;

[0043] Outer primer B3: GGCCTATACAAGACCGAGCT, as shown in SEQ ID NO: 2;

[0044] Internal primer FIP: GCCTCTACCAGTACTGCGGCTTTTGAGCGTAGTAGGCAGCCT, as shown in SEQ ID NO: 3;

[0045] Internal primer BIP: GTTGAACCAGTCGACCCAGCGTTTTAACCCGGCAAGCCCT, as shown in SEQ ID NO: 4;

[0046] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container.

[0047] (3) Prepare the reaction solution: the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, and internal primer FIP per 1L 2 mol of each BIP and 0.25 mol of each outer primer F3 / B3 were prepared and placed in a container.

[0048] (4) Preparation of Lysis Solution 1: Lysis S...

Embodiment 2

[0060] The preparation of embodiment 2 kit

[0061] The reaction solution contains 1.6mmol dNTP, 20mmol Tris-Cl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, 1.6mol each of internal primer FIP / BIP and external primer per 1L Prepare 0.2mol each of F3 / B3 and place in the container.

[0062] Lysis solution 1 contains 20mmol of Tris-HCl with pH8.3, 100mmol of KCl, 5mmol of MgCl per 1L 2 , 10ml Triton X-100, 10ml Tween-20 and 0.2g gelatin preparation.

[0063] The chromogenic solution is EvaGreen.

[0064] Others are the same as embodiment 1.

Embodiment 3

[0065] Example 3 Application of Mycobacterium tuberculosis Gene Rapid Diagnostic Kit

[0066] (1) Purpose of the experiment

[0067] The sensitivity, specificity and accuracy of the Mycobacterium tuberculosis LAMP gene rapid detection kit (Example 1) developed by Guangzhou Huafeng Biotechnology Co., Ltd. were evaluated. Understand the impact of the processing of clinical samples on the test results of the kit, and provide a basis for evaluating the practicability of the product.

[0068] (2) Selection of reference reagents

[0069] The conventional reagents used in the daily detection of Dongguan Infectious Disease Hospital and the Mycobacterium tuberculosis fluorescent quantitative PCR detection kit produced by Shenzhen Piji Bioengineering Co., Ltd. were used as controls.

[0070] The tested reagent was the Mycobacterium tuberculosis LAMP gene rapid detection kit (Example 1) developed by Guangzhou Huafeng Biotechnology Co., Ltd.

[0071] (3) Selection of research objects ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a mycobacterium tuberculosis gene rapid diagnostic kit based on loop-mediated isothermal amplification technology and detection method thereof. The kit consists of the following materials: two pairs of primers, DNA polymerase, reaction solution, lysate 1, lysate 2, stabilizing solution, color developing solution and positive control solution which are respectively contained in vessels. The gene rapid diagnostic kit has six sections and four primers and can be used for determining whether a target substance exists according to amplification situations, thus having high specificity. The gene rapid diagnostic kit is rapid, efficient and highly sensitive, and amplification reaction only requires constant temperature without a special reagent and special equipment. The gene rapid diagnostic kit has convenient identification, pyrophosphoric acid ions separated from dNTP are bonded with Mg in the reaction solution to produce a by-product magnesium pyrophosphate precipitate which can be identified by visual inspection, and negative and positive results show significant difference in color development after the color developing solution is added, which is more obvious and reliable.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a rapid diagnosis kit of mycobacterium tuberculosis gene based on a loop-mediated isothermal amplification technique and a detection method thereof. Background technique [0002] At present, there are many detection methods for Mycobacterium tuberculosis, ranging from the national standard (GB / T4789.7-2003) focusing on the isolation and identification of pathogenic microorganisms, morphological identification and automatic biochemical identification, to the immunological detection technology of specific proteins, nucleic acid Molecular biological detection methods such as probes and polymerase chain reaction (PCR) technology [Food Safety Testing and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try to break through the t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68G01N21/78G01N21/82C12R1/32
Inventor 曹以诚杜正平谭慧媚陈洵邓小玲柯昌文
Owner GUANGZHOU HUAFENG BIOTECH