54 results about "Chinese softshell turtle" patented technology

The utility model relates to the technical field of aquaculture, and particularly discloses a movable Chinese softshell turtle floating spawning site which comprises a bottom plate, a spawning room frame structure is detachably arranged on the bottom plate, and a spawning room is formed in the space between the spawning room frame structure and the bottom plate. A floating cavity and a buoyancy piece are arranged at the bottom of the bottom plate, a positioning assembly is arranged at the bottom of the floating cavity, and a fixing anchor assembly is arranged at the bottom of the positioning assembly. A frame-shaped inlet and a frame-shaped outlet are formed in the opposite sides of the spawning room frame structure respectively; a house entering ladder is arranged at the frame-shaped inlet; a house outlet ladder is arranged at the frame-shaped outlet, and the surface of the house outlet ladder is a smooth inclined surface; a lifting structure is arranged on the oviposition room frame structure, a plurality of single-layer oviposition plates are detachably arranged on the lifting structure, oviposition cavities are formed in the single-layer oviposition plates, and landslide sections for guiding the oviposition cavities are arranged on the single-layer oviposition plates; a climbing section for guiding the oviposition cavity is arranged on the single-layer oviposition plate. The device has the advantages of being movable in arrangement mode, good in flexibility and low in moving cost.

The invention relates to a specific primer pair for sex identification of Chinese softshell turtles and an identification method thereof.The primer pair comprises two pairs of primers which are used for amplifying specific sequences in genome DNA of the Chinese softshell turtles respectively so as to achieve accurate sex identification, and according to the method, the genome DNA of a to-be-detected sample can be amplified through a PCR amplification reaction; when the amplification product is 1000 bp, the sex is judged, when the amplification product is 1000 bp and 2000 bp, the sex is judged, according to the identification method provided by the invention, standard PCR amplification conditions and a reaction system are adopted, high efficiency and accuracy of sex identification are ensured, the invention further provides a kit, and the kit can be used for detecting the sex. The kit comprises a reagent for extracting DNA (deoxyribonucleic acid), a primer combination and a reaction system required by PCR (polymerase chain reaction) amplification as well as an electrophoretic buffer solution and a labeling reagent required by agarose gel electrophoresis, is beneficial to improving the sex identification efficiency and accuracy of the Chinese softshell turtles, and is widely applicable to sex screening and other related researches in the aquaculture industry.

The application relates to the technical field of Chinese soft-shelled turtles, in particular to primers, a kit and a method for identifying the genders of Chinese soft-shelled turtles and application. The genomic DNA of male and female individuals of Chinese soft-shelled turtles is respectively subjected to PCR amplification by using the primer pair, and male-specific fragments and female-specific fragments can be obtained. The primer pair, the kit and the method provided in the embodiments can effectively distinguish female individuals and male individuals of Chinese soft-shelled turtles.

The application discloses an Aeromonas hydrophila bacteriophage and application thereof, and the taxonomic name of the bacteriophage is Aeromonas hydrophila The application discloses an Aeromonas hydrophila bacteriophage and application thereof, and the taxonomic name of the bacteriophage is PTS0531-2, which is preserved in the Guangdong Microbial Culture Collection Center, and the preservation date is March 18, 2026, the preservation number is GDMCC No: 67971-B1, and the preservation address is No. 59, Block 5, 100, Martyrs' Road, Guangzhou. The Aeromonas hydrophila bacteriophage has a strong lysis effect on Aeromonas hydrophila derived from Chinese soft-shelled turtles, and can be used for preventing and controlling Aeromonas hydrophila in a Chinese soft-shelled turtle breeding environment or in vivo.

The invention relates to an isolated culture method of functional Chinese softshell turtle ovarian granular cells. The isolated culture method comprises the following steps: S1, collecting ovarian tissues: collecting Chinese softshell turtle ovarian tissues; s2, separating and collecting a granular cell layer; s3, digesting and collecting granular cells; s4, primary culture of granulosa cells: transferring the collected cells into a cell culture bottle containing 4 ml of a complete culture medium for primary culture, wherein the complete culture medium comprises the following main components: a DMEM culture medium, 15% of fetal calf serum, 1% of penicillin streptomycin and 1% of an insulin-transferrin-selenium additive; and S5, subculturing the granular cells. The isolated culture method and the culture medium system provided by the invention are simpler and more time-saving and labor-saving; according to the method, the aromatase CYP19A1 can be expressed normally, the characteristics of the granular cells are kept, the aromatase CYP19A1 can be expressed normally, it is indicated that the in-vitro cultured cells can keep the functionality of the cells, and the in-vitro proliferation capacity of the granular cells is improved to a great extent.

The invention belongs to the field of feeding for Chinese softshell turtle breeding, and particularly relates to a feeding device for Chinese softshell turtle breeding, which comprises a main body and an automatic feeding device, the automatic feeding device comprises a feeding hopper, the feeding hopper is located in the lifting device, the feeding hopper is a right trapezoid body with the top and the bottom being open, a quantity limiting device is arranged in the feeding hopper, a fixing table is fixedly arranged at the bottom of the feeding hopper, a threaded sleeve is fixedly arranged in the fixing table, and the threaded sleeve is fixedly connected with the lifting device. A threaded rod is in threaded connection with one side of the threaded sleeve, and a second servo motor is arranged at the end, away from the threaded sleeve, of the threaded rod in a transmission mode. A second servo motor in the automatic feeding device is started, the second servo motor rotates to drive a threaded rod to rotate, the threaded rod rotates to drive a threaded sleeve and a fixing table to move, the fixing table moves to drive a feeding hopper to move, and therefore the feeding hopper can stretch out and draw back to adapt to glass water tanks arranged in a trapezoid mode.

The application relates to the technical field of Chinese soft-shelled turtles, in particular to primers, a kit and a method for identifying the genders of Chinese soft-shelled turtles and application. The genomic DNA of male and female individuals of Chinese soft-shelled turtles is respectively subjected to PCR amplification by using the primer pair, and male-specific fragments and female-specific fragments can be obtained. The primer pair, the kit and the method provided in the embodiments can effectively distinguish female individuals and male individuals of Chinese soft-shelled turtles.

The invention discloses a feed feeding device for Chinese softshell turtle culture, which comprises a supporting assembly, the supporting assembly comprises a cross beam mechanism, a floating block is fixedly connected to the cross beam mechanism, a land supporting mechanism is fixedly connected to the cross beam mechanism, and an underwater supporting mechanism is arranged at one end of the cross beam mechanism; the feed throwing assembly comprises a feed box, the feed box is slidably arranged on the cross beam mechanism through a connecting mechanism, a first motor is arranged at the bottom of the feed box and is in transmission connection with the cross beam mechanism through a transmission mechanism, a feeding port and a discharging port are formed in the feed box, the discharging port communicates with a discharging pipe, and a pushing mechanism is arranged in the feed box. The pushing mechanism pushes the feed into the discharging pipe, and the adjusting mechanism is arranged on the discharging pipe; and the controller is fixedly connected to the outer side wall of the material box, and the controller is electrically connected with a remote controller. According to the device, feed can be put into the Chinese softshell turtles at the designated position, meanwhile, workers can be prevented from entering water, the labor intensity of the workers is reduced, and use is more convenient.

The invention discloses a feed additive for rapidly improving metabolic syndrome of carnivorous aquatic animals. Every 1000g of the feed additive comprises the following components: 20 to 40g of tea polyphenol, 0.5 to 2g of nuciferine, 8 to 25g of ginkgetin, 3 to 8g of glycyrrhetinic acid, 0.5 to 1.5 g of sennoside, 5 to 10g of glutathione, 0.1 to 5g of ginsenoside, 0.1 to 0.5 g of bile acid, 1 to 5g of vitamin C, 0.1 to 0.5 g of vitamin E, 0.01 to 0.05 g of vitamin K and the balance of a carrier. The feed additive is prepared according to the principle of monarch, minister, assistant and guide, and can quickly improve the metabolic syndrome symptom of carnivorous aquatic animals. Experiments show that the additive can recover healthy appearance of the liver, regulate blood sugar and blood fat, enhance oxidation resistance and relieve inflammatory response within a short period of 3-4 days. The feed additive is safe, efficient, free of toxic and side effects, low in cost and suitable for various carnivorous aquatic animals such as micropterus salmoides, Chinese softshell turtles and sturgeons, an efficient and safe solution is provided for prevention and control of the metabolic syndrome of the aquatic animals, and the feed additive has good popularization value.

The invention relates to the technical field of Chinese softshell turtles, in particular to primers, a kit and a method for identifying gender of Chinese softshell turtles and application. The primer pair is used for respectively carrying out PCR (Polymerase Chain Reaction) amplification on genome DNAs (Deoxyribose Nucleic Acid) of male individuals and female individuals of the Chinese softshell turtles, so that male specific fragments and female specific fragments can be respectively obtained. The primer pair, the kit and the method provided by the embodiment of the invention can effectively distinguish female individuals and male individuals of the Chinese softshell turtles.

The present application relates to the technical field of sex identification of Chinese soft-shelled turtle, and specifically to primers, kits, methods and applications for sex identification of Chinese soft-shelled turtle. The primers, kits, methods and applications are based on the target sequence shown in SEQ ID NO:3, and can accurately amplify Chinese soft-shelled turtle genomic DNA, and can accurately identify the sex of the soft-shelled turtle based on the amplified product. The PCR amplification product is further subjected to lateral flow test strip chromatography reaction, which can realize visual sex identification of Chinese soft-shelled turtle, has strong identification versatility, a wide identification range, and has very wide application value.

The invention provides a Chinese softshell turtle embryonic stage gonad sampling and tissue slice preparation method, and belongs to the technical field of microscopic tissue sections.The Chinese softshell turtle embryonic stage gonad sampling and tissue slice preparation method comprises the following steps that S1, a sample is exposed; s2, curing the sample; s3, trimming the sample; s4, pre-embedding is carried out; s5, dehydration and wax dipping; s6, shaping and slicing; s7, dewaxing is conducted; s8, dyeing; and S9, sheet sealing. According to the Chinese softshell turtle embryonic stage gonad sampling and tissue slice preparation method, a mounting method is adopted for fixing the middle kidney-gonad tissue, trimming is convenient, the Chinese softshell turtle embryonic stage gonad tissue can be collected in a lossless mode, meanwhile, the used alcohol sol loading substance can be rapidly removed through ethyl alcohol, residues are avoided, the cost is low, and in addition, the method is suitable for large-scale popularization and application. The slice preparation method provided by the invention is simple to operate, small in sample damage and convenient to observe.

The invention provides an auxiliary device and method for sex determination of Chinese softshell turtle embryos and juvenile softshell turtles, and the sex of a sample is determined by calculating the length ratio of gonads to middle kidneys and judging whether the ratio is greater than the slope of a sex determination line, and the slope is 0.59 + / -0.01. The device comprises a bottom plate, an upper cover plate, a middle kidney limiting plate, a homogeneous shaping blade and a fixed string, and assists in sex determination. The bottom plate is used for bearing a gonad-middle kidney-adrenal compound, the upper cover plate provides fixing and measuring functions, the middle kidney position is fixed by the middle kidney limiting plate, redundant tissues are cut off by the homogeneous modification blade, and the gonad is kept stable by the fixing string. The method comprises the steps of sample preparation, fixation, treatment, measurement and sex determination. The gender is determined by measuring the length ratio of gonad to middle kidney, and the accuracy is verified by combining slice preparation, dehydration transparentizing, dyeing and microscopic observation. The method is simple in structure, standard in process, suitable for sex screening of embryos and juvenile soft-shelled turtles of different day ages, and high in efficiency, low in cost and high in applicability.

The invention provides a specific primer for trionychidae sex identification and a detection method thereof. The specific primer comprises a forward primer 5 'GGTGATGGTGGTACTGGTAAAAC3'and a reverse primer 5' GCAGACCACCAAATTTCCTG3 ', and the forward primer 5' GGTGATGGGTGGTACTGTAAAAC3 'and the reverse primer 5' GCAGACCACCAAATTTCCTG3 'are The method for carrying out sex identification by using the primer comprises the following steps: extracting genome DNA of a trionychidae individual to be detected; carrying out PCR (Polymerase Chain Reaction) amplification by adopting the specific primer; and carrying out electrophoresis detection on the amplified product, judging that the amplified product is male when only 250bp bands appear, and judging that the amplified product is female when 250bp and 600bp bands appear at the same time. The method is suitable for sex determination and PCR amplification system and program parameter optimization of trionychidae animals such as Chinese softshell turtles, horns and apalone ferox, and 1.5% agarose gel electrophoresis detection is adopted. The invention also provides a trionychidae animal sex identification kit containing the primer pair, and the invention provides a rapid, accurate, simple and convenient trionychidae animal sex identification method, which can be applied to the breeding and cultivation management of trionychidae animals, and has high commercial value.

The application relates to a Chinese soft-shelled turtle egg hatching method and relates to the technical field of aquaculture. The hatching method comprises the following steps: wrapping collected turtle eggs with yellow sand and storing the turtle eggs; temporarily storing the stored turtle eggs and removing unfertilized eggs after development; wrapping the fertilized eggs with a hatching medium, wherein the hatching medium comprises the following raw materials in parts by weight: 5-10 parts of yellow sand, 2-5 parts of vermiculite and 1-3 parts of organic modified montmorillonite; arranging the fertilized eggs into a hatching layer; and hatching the hatching layer in a hatching environment with a temperature of 28-32 DEG C and a humidity of 60-80%, to obtain juvenile turtles. The application uses the adsorption of organic modified montmorillonite to preserve the moisture in the yellow sand. The organic modified montmorillonite has good air permeability, and even if the moisture is preserved, there will be no odor or mildew, so that the oxygen required for the hatching of the fertilized eggs can be ensured, the fertilized eggs can develop healthily, the physical quality of the hatched juvenile turtles is better, and the juvenile turtles are more likely to survive when released.

The application relates to the technical field of aquaculture, and discloses a device suitable for batch transportation and sale of Chinese soft-shelled turtles, which comprises a belly-shield ring and an outer fixing box arranged outside the belly-shield ring, the belly-shield ring comprises a supporting plate, the two ends of the supporting plate are upturned, and the middle part of the supporting plate is horizontal, the bottom end of the supporting plate is fixedly provided with a bottom plate, the two sides of the bottom plate are both provided with limiting plates which are connected with each other, the bottom of the outer fixing box is open, and the bottom end of the outer fixing box is provided with a sealing plate; the device is divided into the belly-shield ring and the outer fixing box, the belly-shield ring is designed by taking the characteristic that the Chinese soft-shelled turtles like to drill holes, the cross section of the belly-shield ring is in the shape of a cylinder with a'' character, the belly-shield ring has a certain supporting effect and a certain width, the bottom of the belly-shield ring is in the shape of a flat boat, the two ends are upturned, when the Chinese soft-shelled turtles drill into the belly-shield ring, the back shield is extruded due to the cavity bending, so that the fixing effect is achieved, the Chinese soft-shelled turtles are protected from rubbing and other injuries, and the infection caused by the body damage is reduced.

The application relates to the technical field of aquaculture, in particular to a composition, a feed additive, a feeding method and application. Embodiments disclose a composition composed of cinnamyl aldehyde, thymol, carvacrol and lauric acid monoglyceride, which is used for feeding Chinese soft-shelled turtles and grass carp, can effectively promote the growth of the Chinese soft-shelled turtles and the grass carp, improve the daily weight gain of livestock and poultry, improve the feed conversion rate, improve the meat quality and the protein content, improve the immune capacity of the aquaculture animals, and has the characteristics of easy availability of raw materials and low cost.

The utility model discloses an umbrella net device for greenhouse cultivation of Chinese softshell turtles, which is hung upside down above the water surface of a cultivation pool and can be opened and closed like a normal umbrella, and the edge of the opened umbrella net device is positioned below the water surface in the cultivation pool. The edge of the closed umbrella net device is higher than the water surface of the culture pond, and an umbrella cover of the umbrella net device is composed of net pieces. When the umbrella net device arranged on the water surface is closed or incompletely opened, the rest space of the Chinese softshell turtles can be increased, the unit breeding density of the breeding pool is improved, energy supply is concentrated, and waste is avoided; the Chinese softshell turtles climb on the umbrella net device to have a rest, and the biting problem can be avoided; the open umbrella net device is used for catching the Chinese softshell turtles, so that the difficulty of catching the Chinese softshell turtles in the greenhouse culture pond is reduced; the device is simple in structure, convenient to install, good in application prospect and suitable for wide application and popularization.

The application discloses a primer pair, a kit, a method for identifying the gender of Chinese soft-shelled turtles and application of the method. The primer pair comprises an upstream primer shown in SEQ ID NO: 2 and a downstream primer shown in SEQ ID NO: 3. The inventors of the application find a female-specific fragment SEQ ID NO: 1 by performing genome sequencing on male and female Chinese soft-shelled turtles, and design the above primer pair based on the fragment. The primer pair is used to perform PCR amplification on the genomic DNA of Chinese soft-shelled turtles as a template, and a 548 bp specific band containing the sequence shown in SEQ ID NO: 1 can be amplified from female individuals, and no band can be amplified from male individuals. The application further discloses a kit containing the primer pair, a method for identifying the gender of Chinese soft-shelled turtles and application of the primer pair, the kit or the method in gender identification and breeding of Chinese soft-shelled turtles. The application provides a new molecular marker selection for gender identification of Chinese soft-shelled turtles, and is simple in operation, rapid in detection and clear and reliable in result.

The present application relates to the technical field of Chinese soft-shelled turtle breeding, and discloses a Chinese soft-shelled turtle feed and a preparation method thereof. The ingredients of the Chinese soft-shelled turtle feed include cod meal, anchovy meal, black soldier fly meal, starch, soybean meal, minerals, multivitamins, coated vitamin C, emulsified fish oil and lactic acid bacteria, as well as fermentation products of water boat stink bugs and probiotic Bacillus, and fermentation products of cicada and bifidobacterium. Water boat stink bugs contain aliphatic substances with medium-length carbon chains and no branches. After water boat stink bugs are fermented by probiotic Bacillus, growth factors that can promote the growth and development of Chinese soft-shelled turtles are formed. There are proteins in cicadas that can be spun. After fermentation of cicadas and bifidobacteria, growth factors that can regulate hormone secretion in Chinese soft-shelled turtles are formed, promoting the growth and development of Chinese soft-shelled turtles. The combination of the above ingredients provides the nutrients needed for the growth of Chinese soft-shelled turtles, promotes the development of Chinese soft-shelled turtles, and improves the edible taste of Chinese soft-shelled turtles.

The application discloses a Chinese soft-shelled turtle sleep-promoting liver-protecting feed containing Zizyphus jujuba Mill. cake extract and a preparation process thereof. The feed is composed of basic puffed particles and a functional rheological type composite liquid coated on the surface of the basic puffed particles. The basic puffed particles are made of white fish meal, alpha-starch, fermented peeled soybean meal and a compound vitamin and mineral premix. The functional rheological type composite liquid is composed of purified water, low methoxyl pectin, a natural low eutectic solvent reaction substrate and Zizyphus jujuba Mill. cake extract dry powder. In the preparation process, the functional rheological type composite liquid is pressed into the pores of the basic puffed particles through a vacuum post-spraying process. The low methoxyl pectin and the dissociated divalent calcium ions in the compound vitamin and mineral premix are subjected to coordination crosslinking reaction, so that a spatial network hydrogel is formed in situ in the pores. The application effectively avoids the damage of extrusion puffing high temperature to heat-sensitive active components and reduces the dissolution loss of active substances in water.

The application relates to the technical field of aquaculture, and particularly discloses a movable Chinese soft-shelled turtle floating oviposition field and an application method, which comprises a bottom plate, a detachable oviposition house frame structure arranged on the bottom plate, and a space formed between the oviposition house frame structure and the bottom plate as an oviposition house; a floating cavity and a buoyancy piece are arranged at the bottom of the bottom plate, a positioning assembly is arranged at the bottom of the floating cavity, and a fixed anchor assembly is arranged at the bottom of the positioning assembly; a frame-shaped entrance and a frame-shaped exit are respectively arranged at opposite sides of the oviposition house frame structure; an entrance ladder is arranged at the frame-shaped entrance; an exit ladder is arranged at the frame-shaped exit, and the surface of the exit ladder is a smooth inclined surface; a lifting structure is arranged on the oviposition house frame structure, a plurality of single-layer oviposition plates are detachably arranged on the lifting structure, an oviposition cavity is arranged in each single-layer oviposition plate, and a sliding section of the oviposition cavity is arranged on each single-layer oviposition plate; and a climbing section of the oviposition cavity is arranged on each single-layer oviposition plate. The application has the characteristics of movable setting mode, good flexibility and low moving cost.

The invention belongs to the technical field of aquaculture feeds, and particularly relates to a compound feed for juvenile Chinese soft-shelled turtles and a preparation method of the compound feed. The compound feed for the juvenile trionyx sinensis is prepared from the following raw materials: white fish meal, cuttlefish liver powder, composite vegetable protein, alpha-starch, fish oil, threonine, methionine, lysine, taurine, a vitamin premix and a mineral premix. By optimizing the components and proportion of the composite vegetable protein, exerting the complementary effect of amino acids and combining with amino acid supplementation, nutrition balance can be achieved, the palatability and digestion and absorption efficiency of the feed are guaranteed through synergism of all the components, and on the premise that the use amount of animal protein is remarkably reduced and the cost is saved, the production cost is reduced. The feeding rate, the feed conversion rate and the stable growth performance of the juvenile Chinese softshell turtles are ensured, and an economical and efficient feed solution is provided for sustainable development of the Chinese softshell turtle breeding industry.

The invention relates to the technical field of aquatic organisms, and particularly discloses a primer pair and method for identifying the genetic sex of Chinese softshell turtles and application of the primer pair. The primer pair comprises 13448-F shown in SEQ ID NO.2 and 13448-Rshown in SEQ ID NO.3. The method comprises the steps that DNA of a sample to be detected is extracted, PCR amplification is conducted through the primer pair, and the sex is judged according to the agarose gel electrophoresis detection result. The primer pair provided by the invention can realize accurate and lossless sex identification in an embryonic stage or a juvenile soft-shelled turtle stage, and provides a key tool for genetic sex control breeding and unisexual fry production of the Chinese soft-shelled turtles.

The present application belongs to the technical field of molecular marker assisted breeding, and particularly relates to a SNP marker for identifying the genetic sex of Chinese soft-shelled turtles, a primer pair, a kit and application, wherein the SNP marker is located at the 106th and / or 109th base of the nucleotide sequence shown in SEQ ID NO. 3, when the 106th base is TT genotype, the to-be-tested Chinese soft-shelled turtle individual is male, and when the 106th base is TG genotype, the to-be-tested Chinese soft-shelled turtle individual is female; when the 109th base is GG genotype, the to-be-tested Chinese soft-shelled turtle individual is male, and when the 109th base is GA genotype, the to-be-tested Chinese soft-shelled turtle individual is female. The sex-specific SNP marker provided by the present application can realize the conversion of the judgment of the sex trait of the Chinese soft-shelled turtle individual into the judgment of the genotype of the molecular marker, and through the detection of the genotype of the molecular marker, the sex identification can be carried out quickly, efficiently, accurately and with high throughput at the genetic level.

The present application discloses a feed composition, a feeding method for Chinese soft-shelled turtles and uses thereof. The feed composition includes, by mass parts, white fish meal containing 65% protein, white fish meal containing 58% protein, chicken meal, soybean meal, high-gluten flour, raw cassava starch, soybean oil, calcium dihydrogen phosphate, choline chloride, table salt, a premix for turtles and soft-shelled turtles, L-lysine hydrochloride, DL-methionine and 75% tannic acid. The feed composition can promote the growth of Chinese soft-shelled turtles, improve the antioxidant capacity of Chinese soft-shelled turtles, enhance the anti-inflammatory response ability and improve the immune function of Chinese soft-shelled turtles.

The invention relates to the technical field of aquaculture, in particular to a preparation method of a phage compound preparation of Chinese softshell turtles. The method comprises the following steps: S1, respectively separating bacillus cereus, vibrio parahaemolyticus and aeromonas hydrophila from soft-shelled turtle bodies suffering from head shaking disease, nail rot disease and hemorrhagic disease, and mixing to prepare a multi-host bacterial suspension, mixing the multi-host bacterium suspension with an environmental bacteriophage sample, performing enrichment induction, screening out a target bacteriophage, and performing purification culture to obtain a bacteriophage proliferation solution; s2, purifying the bacteriophage proliferation liquid to remove endotoxin to obtain a high-purity bacteriophage solution; and S3, preparing the high-purity bacteriophage liquid and the embedding material into the micro-capsule oral preparation through an electrostatic spraying device. The preparation method comprises the following steps: directionally screening high-cracking bacteriophages aiming at main pathogenic bacteria of soft-shelled turtles, constructing a bacteriophage combination, preparing a targeted microcapsule preparation by combining an electrostatic spraying technology through a constructed composite embedding structure, and cooperating with a bacteriophage synergist, so that spectral antibiosis can be realized, and the stability of the preparation is improved.

The invention discloses a traditional Chinese medicine composition for resisting Chinese softshell turtle source bacillus cereus as well as a preparation method and application of the traditional Chinese medicine composition. The traditional Chinese medicine composition for resisting the Chinese softshell turtle source bacillus cereus is prepared from the following raw materials in parts by weight: 10 parts of astragalus membranaceus alcohol extract, 5 parts of magnolia officinalis alcohol extract and 3 parts of astragalus membranaceus alcohol extract. The traditional Chinese medicine compound can effectively reduce economic loss caused by bacillus cereus outbreak to Chinese softshell turtle breeding, and is low in cost, simple in use method and beneficial to popularization and application.

The invention belongs to the technical field of antibacterial peptides, and particularly relates to beta-defensin produced by Chinese softshell turtles as well as a coding gene and application of the beta-defensin. In order to provide the novel antibacterial peptide, the amino acid sequence of the beta-defensin produced by the Chinese softshell turtle is shown as SEQ NO.2, and the nucleotide sequence of the coding gene of the beta-defensin is shown as SEQ NO.1.

The invention relates to the technical field of breeding of aquaculture varieties, in particular to a breeding method of rapid growth type Chinese softshell turtles, which comprises the following steps: S1, taking Chinese softshell turtles as male parents and apalone ferox as female parents, hybridizing to produce F1-generation hybrid turtles, screening out high-quality F1-generation hybrid turtles, and crossbreeding to produce F2-generation hybrid turtles; s2, selecting the F2-generation hybrid soft-shelled turtles as male parents, taking introduced Japanese soft-shelled turtles as female parents, performing hybridization to produce F3-generation hybrid soft-shelled turtles, screening out high-quality F3-generation hybrid soft-shelled turtles, and performing cross crossing to produce F4-generation hybrid soft-shelled turtles; and S3, screening out high-quality F4-generation hybrid turtles, backcrossing the high-quality F4-generation hybrid turtles with the F2-generation hybrid turtles to produce F5-generation hybrid turtles, screening out high-quality F5-generation hybrid turtles, and carrying out cross-crossing fixation to produce a breeding variety. According to the method, the Chinese softshell turtles and the North American florida softshell turtles are taken as parents, the Japanese softshell turtles are introduced, and the growth speed and meat yield of the Chinese softshell turtles are increased by utilizing the advantages of the North American florida softshell turtles and the Japanese softshell turtles on the basis of keeping the performance characteristics of strong adaptability, few diseases and excellent meat quality of the Chinese softshell turtles.