Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

32 results about "Chinese softshell turtle" patented technology

The Chinese softshell turtle (Pelodiscus sinensis) is a species of softshell turtle that is endemic to China (Inner Mongolia to Hainan), with records of escapees—some of which have established introduced populations—in a wide range of other Asian countries, as well as Spain, Brazil and Hawaii.

Movable Chinese softshell turtle floating spawning site

The utility model relates to the technical field of aquaculture, and particularly discloses a movable Chinese softshell turtle floating spawning site which comprises a bottom plate, a spawning room frame structure is detachably arranged on the bottom plate, and a spawning room is formed in the space between the spawning room frame structure and the bottom plate. A floating cavity and a buoyancy piece are arranged at the bottom of the bottom plate, a positioning assembly is arranged at the bottom of the floating cavity, and a fixing anchor assembly is arranged at the bottom of the positioning assembly. A frame-shaped inlet and a frame-shaped outlet are formed in the opposite sides of the spawning room frame structure respectively; a house entering ladder is arranged at the frame-shaped inlet; a house outlet ladder is arranged at the frame-shaped outlet, and the surface of the house outlet ladder is a smooth inclined surface; a lifting structure is arranged on the oviposition room frame structure, a plurality of single-layer oviposition plates are detachably arranged on the lifting structure, oviposition cavities are formed in the single-layer oviposition plates, and landslide sections for guiding the oviposition cavities are arranged on the single-layer oviposition plates; a climbing section for guiding the oviposition cavity is arranged on the single-layer oviposition plate. The device has the advantages of being movable in arrangement mode, good in flexibility and low in moving cost.
Owner:浙江省水产技术推广总站(浙江省渔业检验检测与疫病防控中心)

Primers, kit and method for identifying gender of chinese softshell turtle and application thereof

The application relates to the technical field of Chinese soft-shelled turtles, in particular to primers, a kit and a method for identifying the genders of Chinese soft-shelled turtles and application. The genomic DNA of male and female individuals of Chinese soft-shelled turtles is respectively subjected to PCR amplification by using the primer pair, and male-specific fragments and female-specific fragments can be obtained. The primer pair, the kit and the method provided in the embodiments can effectively distinguish female individuals and male individuals of Chinese soft-shelled turtles.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Aeromonas hydrophila bacteriophage and application thereof

PendingCN122445585A
The application discloses an Aeromonas hydrophila bacteriophage and application thereof, and the taxonomic name of the bacteriophage is Aeromonas hydrophila The application discloses an Aeromonas hydrophila bacteriophage and application thereof, and the taxonomic name of the bacteriophage is PTS0531-2, which is preserved in the Guangdong Microbial Culture Collection Center, and the preservation date is March 18, 2026, the preservation number is GDMCC No: 67971-B1, and the preservation address is No. 59, Block 5, 100, Martyrs' Road, Guangzhou. The Aeromonas hydrophila bacteriophage has a strong lysis effect on Aeromonas hydrophila derived from Chinese soft-shelled turtles, and can be used for preventing and controlling Aeromonas hydrophila in a Chinese soft-shelled turtle breeding environment or in vivo.
Owner:ZHEJIANG WANLI UNIV

Isolated culture method of functional Chinese softshell turtle ovarian granular cells

PendingCN121896153AImprove in vitro proliferation efficiencyEase the difficulty of time-consuming separationCell dissociation methodsCulture processAromatasePenicillin
The invention relates to an isolated culture method of functional Chinese softshell turtle ovarian granular cells. The isolated culture method comprises the following steps: S1, collecting ovarian tissues: collecting Chinese softshell turtle ovarian tissues; s2, separating and collecting a granular cell layer; s3, digesting and collecting granular cells; s4, primary culture of granulosa cells: transferring the collected cells into a cell culture bottle containing 4 ml of a complete culture medium for primary culture, wherein the complete culture medium comprises the following main components: a DMEM culture medium, 15% of fetal calf serum, 1% of penicillin streptomycin and 1% of an insulin-transferrin-selenium additive; and S5, subculturing the granular cells. The isolated culture method and the culture medium system provided by the invention are simpler and more time-saving and labor-saving; according to the method, the aromatase CYP19A1 can be expressed normally, the characteristics of the granular cells are kept, the aromatase CYP19A1 can be expressed normally, it is indicated that the in-vitro cultured cells can keep the functionality of the cells, and the in-vitro proliferation capacity of the granular cells is improved to a great extent.
Owner:ZHEJIANG WANLI UNIV

Feeding device for breeding Chinese softshell turtles

The invention belongs to the field of feeding for Chinese softshell turtle breeding, and particularly relates to a feeding device for Chinese softshell turtle breeding, which comprises a main body and an automatic feeding device, the automatic feeding device comprises a feeding hopper, the feeding hopper is located in the lifting device, the feeding hopper is a right trapezoid body with the top and the bottom being open, a quantity limiting device is arranged in the feeding hopper, a fixing table is fixedly arranged at the bottom of the feeding hopper, a threaded sleeve is fixedly arranged in the fixing table, and the threaded sleeve is fixedly connected with the lifting device. A threaded rod is in threaded connection with one side of the threaded sleeve, and a second servo motor is arranged at the end, away from the threaded sleeve, of the threaded rod in a transmission mode. A second servo motor in the automatic feeding device is started, the second servo motor rotates to drive a threaded rod to rotate, the threaded rod rotates to drive a threaded sleeve and a fixing table to move, the fixing table moves to drive a feeding hopper to move, and therefore the feeding hopper can stretch out and draw back to adapt to glass water tanks arranged in a trapezoid mode.
Owner:ZHEJIANG WANLI UNIV

Primers, kit and method for identifying gender of chinese soft-shelled turtle and application thereof

The application relates to the technical field of Chinese soft-shelled turtles, in particular to primers, a kit and a method for identifying the genders of Chinese soft-shelled turtles and application. The genomic DNA of male and female individuals of Chinese soft-shelled turtles is respectively subjected to PCR amplification by using the primer pair, and male-specific fragments and female-specific fragments can be obtained. The primer pair, the kit and the method provided in the embodiments can effectively distinguish female individuals and male individuals of Chinese soft-shelled turtles.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Feed feeding device for breeding Chinese softshell turtles

The invention discloses a feed feeding device for Chinese softshell turtle culture, which comprises a supporting assembly, the supporting assembly comprises a cross beam mechanism, a floating block is fixedly connected to the cross beam mechanism, a land supporting mechanism is fixedly connected to the cross beam mechanism, and an underwater supporting mechanism is arranged at one end of the cross beam mechanism; the feed throwing assembly comprises a feed box, the feed box is slidably arranged on the cross beam mechanism through a connecting mechanism, a first motor is arranged at the bottom of the feed box and is in transmission connection with the cross beam mechanism through a transmission mechanism, a feeding port and a discharging port are formed in the feed box, the discharging port communicates with a discharging pipe, and a pushing mechanism is arranged in the feed box. The pushing mechanism pushes the feed into the discharging pipe, and the adjusting mechanism is arranged on the discharging pipe; and the controller is fixedly connected to the outer side wall of the material box, and the controller is electrically connected with a remote controller. According to the device, feed can be put into the Chinese softshell turtles at the designated position, meanwhile, workers can be prevented from entering water, the labor intensity of the workers is reduced, and use is more convenient.
Owner:TONGLU COUNTY AGRI & FORESTRY TECH EXTENSION CENT +1

Feed additive for rapidly improving metabolic syndrome of carnivorous aquatic animals and application of feed additive

PendingCN121058820AMetabolism disorderAntipyreticBiotechnologySenna Leaves
The invention discloses a feed additive for rapidly improving metabolic syndrome of carnivorous aquatic animals. Every 1000g of the feed additive comprises the following components: 20 to 40g of tea polyphenol, 0.5 to 2g of nuciferine, 8 to 25g of ginkgetin, 3 to 8g of glycyrrhetinic acid, 0.5 to 1.5 g of sennoside, 5 to 10g of glutathione, 0.1 to 5g of ginsenoside, 0.1 to 0.5 g of bile acid, 1 to 5g of vitamin C, 0.1 to 0.5 g of vitamin E, 0.01 to 0.05 g of vitamin K and the balance of a carrier. The feed additive is prepared according to the principle of monarch, minister, assistant and guide, and can quickly improve the metabolic syndrome symptom of carnivorous aquatic animals. Experiments show that the additive can recover healthy appearance of the liver, regulate blood sugar and blood fat, enhance oxidation resistance and relieve inflammatory response within a short period of 3-4 days. The feed additive is safe, efficient, free of toxic and side effects, low in cost and suitable for various carnivorous aquatic animals such as micropterus salmoides, Chinese softshell turtles and sturgeons, an efficient and safe solution is provided for prevention and control of the metabolic syndrome of the aquatic animals, and the feed additive has good popularization value.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Specific primer for identifying gender of trionychidae and detection method of specific primer

The invention provides a specific primer for trionychidae sex identification and a detection method thereof. The specific primer comprises a forward primer 5 'GGTGATGGTGGTACTGGTAAAAC3'and a reverse primer 5' GCAGACCACCAAATTTCCTG3 ', and the forward primer 5' GGTGATGGGTGGTACTGTAAAAC3 'and the reverse primer 5' GCAGACCACCAAATTTCCTG3 'are The method for carrying out sex identification by using the primer comprises the following steps: extracting genome DNA of a trionychidae individual to be detected; carrying out PCR (Polymerase Chain Reaction) amplification by adopting the specific primer; and carrying out electrophoresis detection on the amplified product, judging that the amplified product is male when only 250bp bands appear, and judging that the amplified product is female when 250bp and 600bp bands appear at the same time. The method is suitable for sex determination and PCR amplification system and program parameter optimization of trionychidae animals such as Chinese softshell turtles, horns and apalone ferox, and 1.5% agarose gel electrophoresis detection is adopted. The invention also provides a trionychidae animal sex identification kit containing the primer pair, and the invention provides a rapid, accurate, simple and convenient trionychidae animal sex identification method, which can be applied to the breeding and cultivation management of trionychidae animals, and has high commercial value.
Owner:ZHEJIANG WANLI UNIV

Incubation method of Chinese soft-shelled turtle eggs

ActiveCN116369277BClimate change adaptationAnimal husbandryUnfertilized EggsJuvenile
The application relates to a Chinese soft-shelled turtle egg hatching method and relates to the technical field of aquaculture. The hatching method comprises the following steps: wrapping collected turtle eggs with yellow sand and storing the turtle eggs; temporarily storing the stored turtle eggs and removing unfertilized eggs after development; wrapping the fertilized eggs with a hatching medium, wherein the hatching medium comprises the following raw materials in parts by weight: 5-10 parts of yellow sand, 2-5 parts of vermiculite and 1-3 parts of organic modified montmorillonite; arranging the fertilized eggs into a hatching layer; and hatching the hatching layer in a hatching environment with a temperature of 28-32 DEG C and a humidity of 60-80%, to obtain juvenile turtles. The application uses the adsorption of organic modified montmorillonite to preserve the moisture in the yellow sand. The organic modified montmorillonite has good air permeability, and even if the moisture is preserved, there will be no odor or mildew, so that the oxygen required for the hatching of the fertilized eggs can be ensured, the fertilized eggs can develop healthily, the physical quality of the hatched juvenile turtles is better, and the juvenile turtles are more likely to survive when released.
Owner:GONG LAOHAN HLDG GRP CO LTD

A device suitable for batch transportation and sale of Chinese soft-shelled turtles

The application relates to the technical field of aquaculture, and discloses a device suitable for batch transportation and sale of Chinese soft-shelled turtles, which comprises a belly-shield ring and an outer fixing box arranged outside the belly-shield ring, the belly-shield ring comprises a supporting plate, the two ends of the supporting plate are upturned, and the middle part of the supporting plate is horizontal, the bottom end of the supporting plate is fixedly provided with a bottom plate, the two sides of the bottom plate are both provided with limiting plates which are connected with each other, the bottom of the outer fixing box is open, and the bottom end of the outer fixing box is provided with a sealing plate; the device is divided into the belly-shield ring and the outer fixing box, the belly-shield ring is designed by taking the characteristic that the Chinese soft-shelled turtles like to drill holes, the cross section of the belly-shield ring is in the shape of a cylinder with a'' character, the belly-shield ring has a certain supporting effect and a certain width, the bottom of the belly-shield ring is in the shape of a flat boat, the two ends are upturned, when the Chinese soft-shelled turtles drill into the belly-shield ring, the back shield is extruded due to the cavity bending, so that the fixing effect is achieved, the Chinese soft-shelled turtles are protected from rubbing and other injuries, and the infection caused by the body damage is reduced.
Owner:ZHEJIANG WANLI UNIV

Compositions, feed additives, feeding methods and uses

The application relates to the technical field of aquaculture, in particular to a composition, a feed additive, a feeding method and application. Embodiments disclose a composition composed of cinnamyl aldehyde, thymol, carvacrol and lauric acid monoglyceride, which is used for feeding Chinese soft-shelled turtles and grass carp, can effectively promote the growth of the Chinese soft-shelled turtles and the grass carp, improve the daily weight gain of livestock and poultry, improve the feed conversion rate, improve the meat quality and the protein content, improve the immune capacity of the aquaculture animals, and has the characteristics of easy availability of raw materials and low cost.
Owner:HUAZHONG AGRI UNIV

A primer pair, a kit and a method for identifying the gender of Chinese soft-shelled turtles and application thereof

PendingCN122629192AGenomic sequencingZooid
The application discloses a primer pair, a kit, a method for identifying the gender of Chinese soft-shelled turtles and application of the method. The primer pair comprises an upstream primer shown in SEQ ID NO: 2 and a downstream primer shown in SEQ ID NO: 3. The inventors of the application find a female-specific fragment SEQ ID NO: 1 by performing genome sequencing on male and female Chinese soft-shelled turtles, and design the above primer pair based on the fragment. The primer pair is used to perform PCR amplification on the genomic DNA of Chinese soft-shelled turtles as a template, and a 548 bp specific band containing the sequence shown in SEQ ID NO: 1 can be amplified from female individuals, and no band can be amplified from male individuals. The application further discloses a kit containing the primer pair, a method for identifying the gender of Chinese soft-shelled turtles and application of the primer pair, the kit or the method in gender identification and breeding of Chinese soft-shelled turtles. The application provides a new molecular marker selection for gender identification of Chinese soft-shelled turtles, and is simple in operation, rapid in detection and clear and reliable in result.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

A feed for promoting sleep and protecting liver of Chinese soft-shelled turtle containing extract of zizyphus jujuba mill seed cake

PendingCN122623781ABiotechnologyMultivitamin
The application discloses a Chinese soft-shelled turtle sleep-promoting liver-protecting feed containing Zizyphus jujuba Mill. cake extract and a preparation process thereof. The feed is composed of basic puffed particles and a functional rheological type composite liquid coated on the surface of the basic puffed particles. The basic puffed particles are made of white fish meal, alpha-starch, fermented peeled soybean meal and a compound vitamin and mineral premix. The functional rheological type composite liquid is composed of purified water, low methoxyl pectin, a natural low eutectic solvent reaction substrate and Zizyphus jujuba Mill. cake extract dry powder. In the preparation process, the functional rheological type composite liquid is pressed into the pores of the basic puffed particles through a vacuum post-spraying process. The low methoxyl pectin and the dissociated divalent calcium ions in the compound vitamin and mineral premix are subjected to coordination crosslinking reaction, so that a spatial network hydrogel is formed in situ in the pores. The application effectively avoids the damage of extrusion puffing high temperature to heat-sensitive active components and reduces the dissolution loss of active substances in water.
Owner:HEBEI NORMAL UNIV

Movable soft-shelled turtle floating spawning ground and application method

The application relates to the technical field of aquaculture, and particularly discloses a movable Chinese soft-shelled turtle floating oviposition field and an application method, which comprises a bottom plate, a detachable oviposition house frame structure arranged on the bottom plate, and a space formed between the oviposition house frame structure and the bottom plate as an oviposition house; a floating cavity and a buoyancy piece are arranged at the bottom of the bottom plate, a positioning assembly is arranged at the bottom of the floating cavity, and a fixed anchor assembly is arranged at the bottom of the positioning assembly; a frame-shaped entrance and a frame-shaped exit are respectively arranged at opposite sides of the oviposition house frame structure; an entrance ladder is arranged at the frame-shaped entrance; an exit ladder is arranged at the frame-shaped exit, and the surface of the exit ladder is a smooth inclined surface; a lifting structure is arranged on the oviposition house frame structure, a plurality of single-layer oviposition plates are detachably arranged on the lifting structure, an oviposition cavity is arranged in each single-layer oviposition plate, and a sliding section of the oviposition cavity is arranged on each single-layer oviposition plate; and a climbing section of the oviposition cavity is arranged on each single-layer oviposition plate. The application has the characteristics of movable setting mode, good flexibility and low moving cost.
Owner:浙江省水产技术推广总站(浙江省渔业检验检测与疫病防控中心)

Compound feed for juvenile Chinese softshell turtles and preparation method of compound feed

The invention belongs to the technical field of aquaculture feeds, and particularly relates to a compound feed for juvenile Chinese soft-shelled turtles and a preparation method of the compound feed. The compound feed for the juvenile trionyx sinensis is prepared from the following raw materials: white fish meal, cuttlefish liver powder, composite vegetable protein, alpha-starch, fish oil, threonine, methionine, lysine, taurine, a vitamin premix and a mineral premix. By optimizing the components and proportion of the composite vegetable protein, exerting the complementary effect of amino acids and combining with amino acid supplementation, nutrition balance can be achieved, the palatability and digestion and absorption efficiency of the feed are guaranteed through synergism of all the components, and on the premise that the use amount of animal protein is remarkably reduced and the cost is saved, the production cost is reduced. The feeding rate, the feed conversion rate and the stable growth performance of the juvenile Chinese softshell turtles are ensured, and an economical and efficient feed solution is provided for sustainable development of the Chinese softshell turtle breeding industry.
Owner:侯金良

Primer pair and method for identifying genetic sex of Chinese softshell turtle and application

The invention relates to the technical field of aquatic organisms, and particularly discloses a primer pair and method for identifying the genetic sex of Chinese softshell turtles and application of the primer pair. The primer pair comprises 13448-F shown in SEQ ID NO.2 and 13448-Rshown in SEQ ID NO.3. The method comprises the steps that DNA of a sample to be detected is extracted, PCR amplification is conducted through the primer pair, and the sex is judged according to the agarose gel electrophoresis detection result. The primer pair provided by the invention can realize accurate and lossless sex identification in an embryonic stage or a juvenile soft-shelled turtle stage, and provides a key tool for genetic sex control breeding and unisexual fry production of the Chinese soft-shelled turtles.
Owner:HUNAN UNIV OF ARTS & SCI

SNP marker, primer pair, kit and application for identifying genetic sex of chinese softshell turtle

The present application belongs to the technical field of molecular marker assisted breeding, and particularly relates to a SNP marker for identifying the genetic sex of Chinese soft-shelled turtles, a primer pair, a kit and application, wherein the SNP marker is located at the 106th and / or 109th base of the nucleotide sequence shown in SEQ ID NO. 3, when the 106th base is TT genotype, the to-be-tested Chinese soft-shelled turtle individual is male, and when the 106th base is TG genotype, the to-be-tested Chinese soft-shelled turtle individual is female; when the 109th base is GG genotype, the to-be-tested Chinese soft-shelled turtle individual is male, and when the 109th base is GA genotype, the to-be-tested Chinese soft-shelled turtle individual is female. The sex-specific SNP marker provided by the present application can realize the conversion of the judgment of the sex trait of the Chinese soft-shelled turtle individual into the judgment of the genotype of the molecular marker, and through the detection of the genotype of the molecular marker, the sex identification can be carried out quickly, efficiently, accurately and with high throughput at the genetic level.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI +1

Preparation method of phage compound preparation of Chinese softshell turtles

The invention relates to the technical field of aquaculture, in particular to a preparation method of a phage compound preparation of Chinese softshell turtles. The method comprises the following steps: S1, respectively separating bacillus cereus, vibrio parahaemolyticus and aeromonas hydrophila from soft-shelled turtle bodies suffering from head shaking disease, nail rot disease and hemorrhagic disease, and mixing to prepare a multi-host bacterial suspension, mixing the multi-host bacterium suspension with an environmental bacteriophage sample, performing enrichment induction, screening out a target bacteriophage, and performing purification culture to obtain a bacteriophage proliferation solution; s2, purifying the bacteriophage proliferation liquid to remove endotoxin to obtain a high-purity bacteriophage solution; and S3, preparing the high-purity bacteriophage liquid and the embedding material into the micro-capsule oral preparation through an electrostatic spraying device. The preparation method comprises the following steps: directionally screening high-cracking bacteriophages aiming at main pathogenic bacteria of soft-shelled turtles, constructing a bacteriophage combination, preparing a targeted microcapsule preparation by combining an electrostatic spraying technology through a constructed composite embedding structure, and cooperating with a bacteriophage synergist, so that spectral antibiosis can be realized, and the stability of the preparation is improved.
Owner:ZHENJIANG DACHENG FISHERY DEV CO LTD

Beta-defensin produced by Chinese softshell turtles as well as coding gene and application of beta-defensin

The invention belongs to the technical field of antibacterial peptides, and particularly relates to beta-defensin produced by Chinese softshell turtles as well as a coding gene and application of the beta-defensin. In order to provide the novel antibacterial peptide, the amino acid sequence of the beta-defensin produced by the Chinese softshell turtle is shown as SEQ NO.2, and the nucleotide sequence of the coding gene of the beta-defensin is shown as SEQ NO.1.
Owner:SHANXI UNIV

Breeding method of rapid growth type Chinese softshell turtles

PendingCN121694279AClimate change adaptationAnimal husbandryApalone feroxChinese softshell turtle
The invention relates to the technical field of breeding of aquaculture varieties, in particular to a breeding method of rapid growth type Chinese softshell turtles, which comprises the following steps: S1, taking Chinese softshell turtles as male parents and apalone ferox as female parents, hybridizing to produce F1-generation hybrid turtles, screening out high-quality F1-generation hybrid turtles, and crossbreeding to produce F2-generation hybrid turtles; s2, selecting the F2-generation hybrid soft-shelled turtles as male parents, taking introduced Japanese soft-shelled turtles as female parents, performing hybridization to produce F3-generation hybrid soft-shelled turtles, screening out high-quality F3-generation hybrid soft-shelled turtles, and performing cross crossing to produce F4-generation hybrid soft-shelled turtles; and S3, screening out high-quality F4-generation hybrid turtles, backcrossing the high-quality F4-generation hybrid turtles with the F2-generation hybrid turtles to produce F5-generation hybrid turtles, screening out high-quality F5-generation hybrid turtles, and carrying out cross-crossing fixation to produce a breeding variety. According to the method, the Chinese softshell turtles and the North American florida softshell turtles are taken as parents, the Japanese softshell turtles are introduced, and the growth speed and meat yield of the Chinese softshell turtles are increased by utilizing the advantages of the North American florida softshell turtles and the Japanese softshell turtles on the basis of keeping the performance characteristics of strong adaptability, few diseases and excellent meat quality of the Chinese softshell turtles.
Owner:ZHENJIANG DACHENG FISHERY DEV CO LTD

A method for isolating and culturing ovary granulosa cells of Chinese soft-shelled turtle

The application discloses a method for separating and culturing ovary granulosa cells of Chinese soft-shelled turtles, which comprises the steps of selecting female Chinese soft-shelled turtles in the positive oviposition period, executing cervical dislocation after anesthesia, killing the turtles, separating ovary tissues, removing redundant parts after washing, separating II-III stage follicles in a basic culture medium, keeping follicle integrity, performing enzyme digestion treatment, removing supernatant through centrifugation, obtaining a precipitate containing ovules with a diameter of 0.1-0.5 cm, resuspending the precipitate by using a mixed culture medium, and inoculating and culturing. The ovary granulosa cells obtained by the separation method have a high yield, the ovary granulosa cells are cultured in the specific mixed culture medium, the method can replace many factors, the amount of added factors is small, the NaHCO3-free culture medium is used, the use of CO2 is reduced, and the ovary granulosa cells obtained are consistent with the in-vivo environment, so that the cost is reduced and the in-vitro survival period of the ovary granulosa cells is prolonged.
Owner:GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY +1

Breeding method of high-quality soft-shelled turtles

The invention relates to the technical field of breeding of aquaculture varieties, in particular to a breeding method of high-quality soft-shelled turtles, which comprises the following steps: S1, hybridizing Chinese softshell turtles serving as male parents and artificial wattle-necked soft-shelled turtles serving as female parents to produce F1-generation hybrid soft-shelled turtles, and crossbreeding the F1-generation hybrid soft-shelled turtles to produce F2-generation hybrid soft-shelled turtles; s2, selecting the F2-generation hybrid soft-shelled turtles as male parents, taking introduced Japanese soft-shelled turtles as female parents, hybridizing to produce F3-generation hybrid soft-shelled turtles, selecting the F3-generation hybrid soft-shelled turtles, and hybridizing the F3-generation hybrid soft-shelled turtles with artificial wattle-necked soft-shelled turtles to produce F4-generation hybrid soft-shelled turtles; s3, the F4-generation hybrid soft-shelled turtles are selected to be backcrossed with the F2-generation Chinese soft-shelled turtles, F5-generation hybrid soft-shelled turtles are produced, the F5-generation hybrid soft-shelled turtles are selected to be crossly crossed and fixed, and a breeding variety is produced. According to the method, Chinese soft-shelled turtles and wattle-necked soft-shelled turtles are taken as parents, Japanese soft-shelled turtles are introduced, and the meat quality and disease resistance are improved by utilizing the advantages of the wattle-necked soft-shelled turtles and the Japanese soft-shelled turtles on the basis of keeping the performance characteristics of strong adaptability and excellent meat quality of the Chinese soft-shelled
Owner:ZHENJIANG DACHENG FISHERY DEV CO LTD

Health-care wine capable of resisting aging, enhancing immunity and prolonging life and preparation process of health-care wine

The invention relates to the technical field of health-care wine, in particular to health-care wine capable of resisting aging, enhancing immunity and prolonging life and a preparation process of the health-care wine capable of resisting aging, enhancing immunity and prolonging life, and the health-care wine capable of resisting aging, enhancing immunity and prolonging life is prepared from the following materials in parts by weight: a wine 1000 parts of Baijiu; animal source components: 5-8 parts of zaocys dhumnade, 5-8 parts of agkistrodon halys, 3-5 parts of deer blood powder and 2-4 parts of Chinese turtle shell; the plant source component comprises a tonifying plant source, a harmonizing plant source and an assistant plant source; according to the invention, the tonifying plant source, the harmonizing plant source and the assistant plant source are combined into the plant source component, and the plant source component and the animal source component form an anti-aging, immune and metabolic regulation network, so that the physiological function of a human body is regulated in a multi-channel manner, and the comprehensive health-care effects of resisting aging, enhancing immune resistance and prolonging life are realized.
Owner:GUIZHOU RONGXIANGTANG HEALTH IND CO LTD

Specific primer pair, primer probe set and application of specific primer pair and primer probe set in detection of pathogenic bacillus cereus of Chinese softshell turtles

The invention discloses a specific primer pair, a primer probe set and application of the specific primer pair and the primer probe set to detection of pathogenic bacillus cereus of Chinese softshell turtles, and particularly relates to the technical field of pathogenic bacterium PCR detection. Wherein the specific primer pair is composed of a primer SYJ-qPCR-F and a primer SYJ-qPCR-R, and the primer SYJ-qPCR-F and the primer SYJ-qPCR-R are used as primers of the specific primer pair; the sequence of the primer SYJ-qPCR-F is as shown in SEQ ID No: 1; and the sequence of the primer SYJ-qPCR-R is as shown in SEQ ID No: 2. The primer probe group comprises the specific primer pair and a probe SYJ-qPCR-P, and the sequence of the probe SYJ-qPCR-P is shown as SEQ ID No: 3. The invention provides a specific primer pair, a primer probe group and application of the specific primer pair to detection of pathogenic bacillus cereus of Chinese softshell turtles. The specific primer pair has the advantages of being high in specificity, high in sensitivity, easy and convenient to operate and capable of being applied on a large scale.
Owner:ZHEJIANG DANSHUI FISHERY RESEARCH INSTITUTE (ZHEJIANG DANSHUI FISHERY ENVIRONMENTAL MONITORING STATION)

A snp marker related to genetic sex of chinese soft-shelled turtle and primer and application thereof

The application discloses a Chinese soft-shelled turtle genetic sex related SNP marker, a primer thereof and application, and relates to the field of genetic sex identification of Chinese soft-shelled turtles. The Chinese soft-shelled turtle genetic sex related SNP marker is a sequence shown in SEQ ID NO:1, wherein bases at positions 164, 167, 172, 173, 174 and 177 from the 5' end are A / G, C / T, T / C, T / C, G / A and C / T. An individual with the SNP marker genotype AG, CT, TC, TC, GA and CT is a female Chinese soft-shelled turtle, and an individual with the SNP marker genotype AA, CC, TT, TT, GG and CC is a male Chinese soft-shelled turtle. The application can quickly, simply and accurately identify the genetic sex of Chinese soft-shelled turtles through corresponding specific marker primers. The method for detecting the genetic sex of Chinese soft-shelled turtles can be used for sex identification and screening of Chinese soft-shelled turtles in different growth stages, different groups and a large number of samples, and has important significance for carrying out sex control breeding of Chinese soft-shelled turtles and developing single-sex breeding.
Owner:HUNAN UNIV OF ARTS & SCI +1

A method for polyculture of shrimp and turtles

This invention discloses a method for shrimp and turtle polyculture, relating to the field of aquaculture technology, including: S1 selecting a flat-bottomed pond with little siltation and setting up escape prevention facilities around the pond; S2 stocking freshwater shrimp and Chinese soft-shelled turtles; S3 setting up separate feeding areas for freshwater shrimp and Chinese soft-shelled turtles in the same pond; S4 water quality adjustment; S5 conducting pond inspections once in the morning and once in the evening every day to handle emergencies; This invention, through the shrimp and turtle polyculture model, can make three-dimensional use of the entire aquaculture pond space. Turtles typically crawl on the bottom of the pond, while shrimp typically swim in the water, thus making reasonable use of the three-dimensional space of the aquaculture pond and improving the utilization rate of aquaculture space.
Owner:QUANJIAO HUAXIHU SPECIAL AQUATIC PROD PROFESSIONAL COOP

SNP (Single Nucleotide Polymorphism) marker, primer pair and kit for identifying genetic sex of Chinese softshell turtles and application

The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to an SNP marker, a primer pair, a kit and application for identifying genetic sex of Chinese softshell turtles, the SNP marker is located at the 106th base and / or 109th base of a nucleotide sequence shown as SEQ ID NO.3, when the 106th base is a TT genotype, when a Chinese softshell turtle individual to be detected is male and TG genotype, the SNP marker is located at the 109th base and / or 109th base of the nucleotide sequence shown as SEQ ID NO.3. The to-be-tested Chinese softshell turtle individuals are female; when the 109th basic group is a GG genotype, the to-be-detected Chinese softshell turtle individual is male, and when the 109th basic group is a GA genotype, the to-be-detected Chinese softshell turtle individual is female. According to the gender-specific SNP marker provided by the invention, the judgment of the individual gender character of the Chinese softshell turtle can be converted into the judgment of the genotype of the molecular marker, and by detecting the genotype of the molecular marker, rapid, efficient, accurate and high-throughput gender identification can be carried out on the genetic level.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI +1

Separation and culture method of Chinese softshell turtle ovarian granular cells

A Chinese softshell turtle ovarian granular cell separation and culture method comprises separation and culture, the separation comprises the following steps: selecting a female Chinese softshell turtle individual in a positive spawning period, anesthetizing the female Chinese softshell turtle individual, killing the female Chinese softshell turtle individual after neck breaking, separating ovarian tissues, cleaning, removing redundant parts, placing the female Chinese softshell turtle individual in a basal culture medium, separating follicles in II-III periods, keeping the integrity of the follicles, performing enzyme digestion treatment, and culturing the follicles in the basal culture medium. And centrifuging to remove the supernatant to obtain a precipitate containing egg granules with the diameter of 0.1-0.5 cm, resuspending the precipitate by adopting a mixed culture medium, and inoculating and culturing. The ovarian granulosa cells separated by the separation method provided by the invention are high in yield, the method for culturing the ovarian granulosa cells in a specific mixed culture medium is diversified in alternative factors and small in added factor amount, meanwhile, a NaHCO3-free culture medium is used, the use of CO2 is reduced, the obtained ovarian granulosa cells are kept consistent with the internal environment of an organism, the cost is reduced, and the method is suitable for large-scale popularization and application. And the in-vitro lifetime of the ovarian granular cells is prolonged.
Owner:GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY +1