Mulberry silkworm pebrine test kit and using method thereof
A microparticle disease and kit technology, applied in the direction of microbe-based methods, microbe measurement/inspection, biochemical equipment and methods, etc., can solve the problem of silkworm microparticle disease that has not been found yet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0117] The preparation of embodiment 1 kit
[0118] 1. Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0119] Outer primer F3(1): (SEQ ID NO 1)
[0120] CAGGAGTTGCTTTTGCGA
[0121] Outer primer B3 (1): (SEQ ID NO 2)
[0122] AAACGGATTCAGCAGGTA
[0123] Internal primer FIP (1): (SEQ ID NO 3)
[0124] GAAAGCGCTGCTCAAAGCAGttttTGTGCCATTGAATGTCAGA
[0125] Internal primer BIP (1): (SEQ ID NO 4)
[0126] CTGCGCTACCAGCGTTGTTAttttATATCACCATCGGTGGAAG.
[0127] 2. Purchase DNA polymerase: Bst DNA polymerase is placed in the container;
[0128] 3. Prepare the reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L KCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / L MgSO 4 ·7H 2 0.125 volume % TritonX-100, 1mol / L betaine, each 0.2 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3, place container;
[0129] 4. Prepare the sample pretreatment solution: the sample...
Embodiment 2
[0149] The preparation of embodiment 2 kit
[0150] 1. Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0151] Outer primer F3 (2): (SEQ ID NO 5)
[0152] CTTTGAGCAGCGCTTTCA
[0153] Outer primer B3 (2): (SEQ ID NO 6)
[0154] GGGTAAATCTGTTAATGGTTCTT
[0155] Internal primer FIP (2): (SEQ ID NO 7)
[0156] GCATACGTAGACGATGCAGGCttttCAGCTTTAGCTGCGCTAC
[0157] Internal primer BIP (2): (SEQ ID NO 8)
[0158] GGCTTCCACCGATGGTGATAttttACACCACAAAAGATGGTACTG.
[0159] 2. Purchase DNA polymerase: Bst DNA polymerase is placed in the container;
[0160] 3. Prepare the reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / L Tris-Cl, 10mmol / L KCl, 10mmol / L (NH 4 ) 2 SO 4 , 8mmol / L MgSO 4 , 0.1% by volume TritonX-100, 0.8mol / L betaine, each 0.25 μmol / L of inner primer FIP / BIP and each 1.2 μmol / L of outer primer F3 / B3 are placed in the container;
[0161] 4. Prepare the sample pretreatment solutio...
Embodiment 3
[0176] Example 3 Silkworm microparticle disease ( Nb ) Application of test kit
[0177] 1.1 Materials
[0178] 1.1.1 Spores
[0179] There are 3 spores used in this study, mainly from South China Agricultural University and Guangdong Provincial Sericulture Technology Promotion Center. See Table 1 for details.
[0180] Table 1 Names and sources of spores
[0181] source of spores
Spore and number
South China Agricultural University
Microspores of Bombyx mori Nb
Production sampling samples
Production inspection sample JC1 from Guangdong Provincial Sericulture Technology Extension Center
[0182] other spores
Microspores of Tussah moth from South China Agricultural University
[0183] 1.1.2 Main instruments and reagents
[0184] 1.2 Identification of isolated spores
[0185] Isolation and identification of clinically isolated spores Extract and number the dried female moths as required. According to each box of...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More