Supercharge Your Innovation With Domain-Expert AI Agents!

Mulberry silkworm pebrine test kit and using method thereof

A microparticle disease and kit technology, applied in the direction of microbe-based methods, microbe measurement/inspection, biochemical equipment and methods, etc., can solve the problem of silkworm microparticle disease that has not been found yet

Inactive Publication Date: 2011-08-17
SOUTH CHINA AGRI UNIV +2
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology. The established loop-mediated isothermal amplification technology (LAMP) has many advantages. In addition, since April 2010 No rapid genetic test kit for detection of silkworm microparticle disease using loop-mediated isothermal amplification technology has been found

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0117] The preparation of embodiment 1 kit

[0118] 1. Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0119] Outer primer F3(1): (SEQ ID NO 1)

[0120] CAGGAGTTGCTTTTGCGA

[0121] Outer primer B3 (1): (SEQ ID NO 2)

[0122] AAACGGATTCAGCAGGTA

[0123] Internal primer FIP (1): (SEQ ID NO 3)

[0124] GAAAGCGCTGCTCAAAGCAGttttTGTGCCATTGAATGTCAGA

[0125] Internal primer BIP (1): (SEQ ID NO 4)

[0126] CTGCGCTACCAGCGTTGTTAttttATATCACCATCGGTGGAAG.

[0127] 2. Purchase DNA polymerase: Bst DNA polymerase is placed in the container;

[0128] 3. Prepare the reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L KCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / L MgSO 4 ·7H 2 0.125 volume % TritonX-100, 1mol / L betaine, each 0.2 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3, place container;

[0129] 4. Prepare the sample pretreatment solution: the sample...

Embodiment 2

[0149] The preparation of embodiment 2 kit

[0150] 1. Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0151] Outer primer F3 (2): (SEQ ID NO 5)

[0152] CTTTGAGCAGCGCTTTCA

[0153] Outer primer B3 (2): (SEQ ID NO 6)

[0154] GGGTAAATCTGTTAATGGTTCTT

[0155] Internal primer FIP (2): (SEQ ID NO 7)

[0156] GCATACGTAGACGATGCAGGCttttCAGCTTTAGCTGCGCTAC

[0157] Internal primer BIP (2): (SEQ ID NO 8)

[0158] GGCTTCCACCGATGGTGATAttttACACCACAAAAGATGGTACTG.

[0159] 2. Purchase DNA polymerase: Bst DNA polymerase is placed in the container;

[0160] 3. Prepare the reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / L Tris-Cl, 10mmol / L KCl, 10mmol / L (NH 4 ) 2 SO 4 , 8mmol / L MgSO 4 , 0.1% by volume TritonX-100, 0.8mol / L betaine, each 0.25 μmol / L of inner primer FIP / BIP and each 1.2 μmol / L of outer primer F3 / B3 are placed in the container;

[0161] 4. Prepare the sample pretreatment solutio...

Embodiment 3

[0176] Example 3 Silkworm microparticle disease ( Nb ) Application of test kit

[0177] 1.1 Materials

[0178] 1.1.1 Spores

[0179] There are 3 spores used in this study, mainly from South China Agricultural University and Guangdong Provincial Sericulture Technology Promotion Center. See Table 1 for details.

[0180] Table 1 Names and sources of spores

[0181] source of spores

Spore and number

South China Agricultural University

Microspores of Bombyx mori Nb

Production sampling samples

Production inspection sample JC1 from Guangdong Provincial Sericulture Technology Extension Center

[0182] other spores

Microspores of Tussah moth from South China Agricultural University

[0183] 1.1.2 Main instruments and reagents

[0184] 1.2 Identification of isolated spores

[0185] Isolation and identification of clinically isolated spores Extract and number the dried female moths as required. According to each box of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a mulberry silkworm pebrine test kit. The mulberry silkworm pebrine (Nb) test kit comprises two pairs of primers which are designed by taking mulberry silkworm pebrine spores as target genes on the basis of a loop-mediated isothermal amplification (LAMP) technology, namely external primers F3 / B3 and internal primers FIP / BIP. The mulberry silkworm pebrine test kit has a more comprehensive detection effect and low omission rate and can replace the conventional microscope detection technologies.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a silkworm microparticle disease ( Nb ) test kit and method of use thereof. Background technique [0002] Bombyx mori microsporidia is a devastating disease caused by the silkworm Microsporidia ( Nosema bombycis , Nb )caused. In history, France, Italy and other countries have almost caused the destruction of sericulture due to the occurrence and prevalence of the disease. The current microscopic inspection is mainly carried out on the female moth rather than the produced silkworm eggs (silkworm eggs), and the results of the female moth inspection sometimes do not fully represent the real situation of the silkworm eggs. Therefore, accurate and rapid detection of silkworm microparticle disease ( Nb ) is of great significance. [0003] At present, the detection method of silkworm microparticulate disease mainly adopts the national standard (GB / T20395-2006) based on the isolat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor 黄自然胡智明冯雪梅邱国祥杜正平余爱群陈洵王先燕曹以诚
Owner SOUTH CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More