Primer group for detecting vibrio coralliilyticus by using LAMP, quick diagnosis kit and detecting method

A rapid diagnosis technology for Vibrio corallilyticus, which is applied in the biological field to achieve the effects of high specificity, mild reaction conditions, and simple instruments

Inactive Publication Date: 2010-04-07
SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] For LAMP, the design of 4 specific primers is the key. There are many requirements for primer design, such as the distance between each primer, Tm value, and the stability of primer ends. Therefore, from 200 to 300 bases It is very difficult to design four primers that meet the requirements in the target sequence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for detecting vibrio coralliilyticus by using LAMP, quick diagnosis kit and detecting method
  • Primer group for detecting vibrio coralliilyticus by using LAMP, quick diagnosis kit and detecting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] The primer set that utilizes LAMP to detect Vibrio corallolyticus provided by this embodiment, this primer set is made up of following outer primer pair and inner primer pair:

[0069] Wherein the outer primer pair is:

[0070] VCF3: TGGTTGCAGGTGACATCAC,

[0071] VCB3: TCTACTGGGCTGTACGTAGC;

[0072] The inner primer pair is:

[0073] VCFIP: CATWGCGATCTCAGCGTTGTCTTTTGATCGCTAACCCAGAACACG,

[0074] VCBIP: TGGTTACGTTCCAGCTTCAGCTTTCAACCAGTAGGCGACCRAT

[0075] where W=A and T; R=A and G.

Embodiment 2

[0077] In the kit for detecting Vibrio corallilyticus using LAMP provided in this example, the primer set used is shown in Example 1, which contains the following reagents that can be separated and packaged:

[0078] a) contains the primer set described in Example 1, and the molar ratio of the outer primer pair and the inner primer pair in the primer set is 1:1~10;

[0079] Wherein the outer primer pair is:

[0080] VCF3: TGGTTGCAGGTGACATCAC,

[0081] VCB3: TCTACTGGGCTGTACGTAGC;

[0082] The inner primer pair is:

[0083] VCFIP: CATWGCGATCTCAGCGTTGTCTTTTGATCGCTAACCCAGAACACG,

[0084] VCBIP: TGGTTACGTTCCAGCTTCAGCTTTCAACCAGTAGGCGACCRAT

[0085] where W=A and T; R=A and G;

[0086] b) Positive control substance: containing the genomic DNA of Vibrio corallilyticus at a concentration of 5-20 mg / mL;

[0087] c) LAMP reaction solution: containing 1× reaction buffer, 0-1.0mmol / LdNTPs, 0.2-1.0mol / L betaine and 0.2-0.8mmol / L MgSO 4 , the 1 × reaction buffer containing 20mM pH 8.8...

Embodiment 3

[0100] For the method of using LAMP to detect coral lytic bacteria provided in this example, see Example 2 for the rapid diagnostic kit used.

[0101] The method for detecting Vibrio corallilyticus by the LAMP is as follows: extract the genomic DNA of the sample to be tested, add the above primer set, LAMP reaction solution, and Bst DNA polymerase into the LAMP reaction system, mix well, perform a constant temperature amplification reaction, and extinguish at 80°C. After activating for 10 minutes, take part of the inactivated liquid product for agarose gel electrophoresis analysis, add the remaining liquid product to the color developing solution, observe the color developing result, and compare the color developing result of the positive control substance at the same time, if the results are consistent, it means The sample to be tested contains Vibrio corallilyticus, if the color development results are inconsistent, it means that the sample to be tested does not contain Vibri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a primer group for detecting vibrio coralliilyticus by using LAMP, a quick diagnosis kit and a detecting method. The primer group comprises an external primer pair and an internal primer pair, wherein the external primer pair is VCF3(TGGTTGCAGGTGACATCAC) and VCB3(TCTACTGGGCTGTACGTAGC); the internal primer pair is VCFIP(CATWGCGATCTCAGCGTTGTCTTTTGATCGCTAACCCAGAACACG) and VCBIP(TGGTTACGTTCCAGCTTCAGCTTTCAACCAGTAGGCGACCRAT); W equals to A and T; and R equals to A and G. The invention also discloses a quick diagnosis kit containing the primer group and a detecting method. The primer group, the quick diagnosis kit and the detecting method have the advantages of short detection time, strong specificity and high detection sensitivity.

Description

technical field [0001] The invention relates to a primer set, a rapid diagnosis kit and a detection method for detecting Vibrio corallilyticus by using LAMP, and belongs to the field of biotechnology. Background technique [0002] Since variegated abalone farming started in 2001, artificially propagated seedlings gradually turned white, fell off and died in large numbers 10-21 days after the seedlings were attached, which affected the source of seedlings and the price of adult shellfish, and endangered the entire abalone farming industry. The epidemic of shedding of cultured abalone seedlings or death of adult abalones not only occurred in the southern coast of China, but similar diseases also occurred in the coastal areas of Taiwan, China. After a long period of monitoring and research, it was determined that the main pathogen causing this large-scale "board drop disease" was Vibriocorallilyticus, which belongs to the genus Vibrio in the Vibrio family. [0003] In order to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/63
Inventor 王江勇王瑞旋刘广锋
Owner SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap