Primer group for detecting vibrio coralliilyticus by using LAMP, quick diagnosis kit and detecting method
A rapid diagnosis technology for Vibrio corallilyticus, which is applied in the biological field to achieve the effects of high specificity, mild reaction conditions, and simple instruments
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] The primer set that utilizes LAMP to detect Vibrio corallolyticus provided by this embodiment, this primer set is made up of following outer primer pair and inner primer pair:
[0069] Wherein the outer primer pair is:
[0070] VCF3: TGGTTGCAGGTGACATCAC,
[0071] VCB3: TCTACTGGGCTGTACGTAGC;
[0072] The inner primer pair is:
[0073] VCFIP: CATWGCGATCTCAGCGTTGTCTTTTGATCGCTAACCCAGAACACG,
[0074] VCBIP: TGGTTACGTTCCAGCTTCAGCTTTCAACCAGTAGGCGACCRAT
[0075] where W=A and T; R=A and G.
Embodiment 2
[0077] In the kit for detecting Vibrio corallilyticus using LAMP provided in this example, the primer set used is shown in Example 1, which contains the following reagents that can be separated and packaged:
[0078] a) contains the primer set described in Example 1, and the molar ratio of the outer primer pair and the inner primer pair in the primer set is 1:1~10;
[0079] Wherein the outer primer pair is:
[0080] VCF3: TGGTTGCAGGTGACATCAC,
[0081] VCB3: TCTACTGGGCTGTACGTAGC;
[0082] The inner primer pair is:
[0083] VCFIP: CATWGCGATCTCAGCGTTGTCTTTTGATCGCTAACCCAGAACACG,
[0084] VCBIP: TGGTTACGTTCCAGCTTCAGCTTTCAACCAGTAGGCGACCRAT
[0085] where W=A and T; R=A and G;
[0086] b) Positive control substance: containing the genomic DNA of Vibrio corallilyticus at a concentration of 5-20 mg / mL;
[0087] c) LAMP reaction solution: containing 1× reaction buffer, 0-1.0mmol / LdNTPs, 0.2-1.0mol / L betaine and 0.2-0.8mmol / L MgSO 4 , the 1 × reaction buffer containing 20mM pH 8.8...
Embodiment 3
[0100] For the method of using LAMP to detect coral lytic bacteria provided in this example, see Example 2 for the rapid diagnostic kit used.
[0101] The method for detecting Vibrio corallilyticus by the LAMP is as follows: extract the genomic DNA of the sample to be tested, add the above primer set, LAMP reaction solution, and Bst DNA polymerase into the LAMP reaction system, mix well, perform a constant temperature amplification reaction, and extinguish at 80°C. After activating for 10 minutes, take part of the inactivated liquid product for agarose gel electrophoresis analysis, add the remaining liquid product to the color developing solution, observe the color developing result, and compare the color developing result of the positive control substance at the same time, if the results are consistent, it means The sample to be tested contains Vibrio corallilyticus, if the color development results are inconsistent, it means that the sample to be tested does not contain Vibri...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 