Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rapid diagnosis reagent kit and detection method for pseudomonas aeruginosa gene

A technology for rapid diagnosis of Pseudomonas aeruginosa, which is applied in the directions of biochemical equipment and methods, determination/inspection of microorganisms, etc., can solve problems such as the genetic rapid diagnosis kit for detecting Pseudomonas aeruginosa, etc., and achieve identification Intuitive and clear results, high specificity, high yield effect

Active Publication Date: 2009-04-08
GUANGZHOU HUAFENG BIOTECH
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology, and the established loop-mediated isothermal amplification technology (loop-mediated isothermal amplification of DNA, LAMP) has many advantages. There is no rapid gene diagnostic kit for detecting Pseudomonas aeruginosa using loop-mediated isothermal amplification technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] The preparation of embodiment 1 kit

[0036] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0037] Outer primer F3: CGCGTACGGATACCTCTCC;

[0038] Outer primer B3: GCACCTTCACCGGAAGCA;

[0039] Internal primer FIP: CGTTGGCGACCGTCAGTTCAGGTTTTCCGCTCAGGGCGATGT;

[0040] Internal primer BIP: AATTCGGCAAATTTGCTGCGCTTTTTCTTGGAGGAGCAACCCACA;

[0041] (2) Purchase DNA polymerase: Bst DNApolymerase (large fragment) and place it in a container.

[0042](3) Preparation of reaction solution: The formula of the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, 2 mol each of primers FIP / BIP and 0.25 mol each of outer primers F3 / B3 were prepared and placed in containers.

[0043] (4) Preparation of sample pretreatment solution: the formula of sample pretreatment solution was prepared by containing 20mmol Tri...

Embodiment 2

[0054] The preparation of embodiment 2 kit

[0055] The formula of the reaction solution is: each 1L reaction solution contains 1.6mmol dNTP, 20mmol Tris-HCl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, internal primer FIP / BIP each 1.6 mol and 0.2mol each of outer primer F3 / B3;

[0056] The formula of the sample pretreatment solution is: every 1L of the sample pretreatment solution contains 10mmol of Tris-HCl with pH8.0, 1mmol of EDTA and 10ml of Triton X-100.

[0057] The chromogenic solution is EvaGreen.

[0058] Others are the same as embodiment 1.

Embodiment 3

[0059] Application of Example 3 Pseudomonas aeruginosa Gene Rapid Diagnostic Kit

[0060] 1. Sample processing (template DNA extraction)

[0061] (1) Take 25g (ml) of food samples by aseptic technique, and carry out bacterial enrichment treatment according to GB7918.4-1987;

[0062] (2) Take 1ml of the enrichment solution and centrifuge at 10000rpm for 2min to obtain bacterial sediment;

[0063] (3) Add 100 μl of sample pretreatment solution to the above cell pellet and mix evenly, boil in boiling water for 10 minutes, immediately place on ice to cool for 10 minutes, centrifuge at 10,000 rpm for 2 minutes, and the supernatant is the sample template DNA.

[0064] 2. The reaction process of loop-mediated isothermal amplification technology

[0065] 1) Prepare a reaction system in a 200 μl reaction tube: 22 μl of reaction solution, 0.5 μl of Bst DNA polymerase (4U), 30 μl of stabilization solution, and 2.5 μl of template DNA.

[0066] 2) React the prepared reaction tube at a c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pore sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a rapid diagnosis kit and a detection method of genes of pseudomonas aeruginosa. The kit consists of two pairs of primers, DNA polymerase, a stabilizing solution, a reaction solution, a sample pre-treatment solution, a color development solution and a positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a rapid diagnosis kit for Pseudomonas aeruginosa gene and a detection method thereof. Background technique [0002] At present, there are a variety of detection methods for Pseudomonas aeruginosa, from the national standard (GB7918.4-1987) based on the isolation and identification of pathogenic microorganisms, morphological identification and automatic biochemical identification, to the immunological detection technology of specific proteins, nucleic acid Molecular biological detection methods such as probes and polymerase chain reaction (PCR) technology [Food Safety Testing and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try to break through the traditional microbiological detection modes such as morphology and bioche...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 曹以诚李志勇杜正平陈洵谭惠媚易敏英
Owner GUANGZHOU HUAFENG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com