Brucella diagnostic kit and use method thereof
A diagnostic kit, Brucella technology, applied in the field of microbial detection, can solve the problems of being unsuitable for clinical and grassroots production, prone to false positive results, and less clinical application, achieving significant color difference, simple identification, The effect of low detection cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] The preparation of embodiment 1 kit
[0029] This kit consists of at least two pairs of specific amplification primers, namely:
[0030] Inner primer FIP: gccatagccaaggtaaagaccggcggttgaagtagctcccca;
[0031] Internal primer BIP: cagcaccgttggcagcatcagatctggtcctgctggaagt;
[0032] Outer primer F3: gacgccatccaggaacag;
[0033] Outer primer B3: gcatcaccttcaacaccgtat;
[0034] The remaining materials in the kit can be solved by outsourcing.
Embodiment 2
[0035] Preferred kit of embodiment 2
[0036] The preferred kit of the present invention should consist of the following:
[0037] Two pairs of the aforementioned specific amplification primers, wherein the concentration of the outer primer is 5 pmol / μL, and the concentration of the inner primer is 20 pmol / μL; Bst DNA polymerase, the activity of Bst DNA polymerase is 8 active units / μL; Deoxyribonucleotide mixture; Buffer; Betaine; Magnesium sulfate; Chromogenic solution and positive control solution, specifically prepared as follows:
[0038] According to the primer sequence in Example 1, the oligodeoxynucleic acid primer was synthesized by a DNA synthesizer, and the concentration of the inner primer was 20 pmol / μL, and the concentration of the outer primer was 5 pmol / μL, and they were respectively packed in containers:
[0039] Purchase Bst DNA polymerase and place it in the container;
[0040] Purchase betaine, configure it at 5mol / L, and install it in containers;
[0041...
Embodiment 3
[0046] The application of embodiment 3 Brucella gene quick diagnostic kits of the present invention
[0047] 1. Sample processing (template DNA extraction)
[0048] Collect the sample to be tested according to the method in 2.4 of NY / T1467-2007, such as blood or emulsion;
[0049]According to the method in 2.5 of NY / T1467-2007, extract the nucleic acid of the sample to be tested to obtain the sample template, or use an equivalent commercial nucleic acid extraction kit to extract the DNA template of the sample to be tested according to the instructions.
[0050] 2. Loop-mediated amplification reaction process
[0051] (1) Reaction system: Add the following reagents into a 0.2ml thin-walled tube:
[0052] 10× Thermopol buffer 2.5 μL
[0053] Betaine 5.0 μL
[0054] 1.2 μL of deoxyribonucleotide mixture
[0055] 2.0 μL each of internal primers (FIP / BIP)
[0056] 1.0 μL each of outer primers (F3 / B3)
[0057] Magnesium sulfate 1.0 μL
[0058] Bst DNA polymerase 1.0 μL
[0...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 