Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Brucella diagnostic kit and use method thereof

A diagnostic kit, Brucella technology, applied in the field of microbial detection, can solve the problems of being unsuitable for clinical and grassroots production, prone to false positive results, and less clinical application, achieving significant color difference, simple identification, The effect of low detection cost

Active Publication Date: 2011-03-09
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although isolation and culture is the best evidence for the diagnosis of brucellosis, it is rarely used in clinical practice due to time-consuming, low bacteria yield and biosafety issues.
Serological detection methods such as SAT are simple and fast, and are also internationally recognized standardized diagnostic methods for brucellosis, but because of their low specificity, especially the presence of Yersinia (O:9) and Brucella antigens Large similarity (Kittelberger, 1997), prone to false positive results
Ordinary PCR method is used to detect pathogenic nucleic acid. Because of its advantages of sensitivity, speed, and no need for live bacteria operation, it has certain value in the diagnosis of brucellosis, but it requires special instruments and cumbersome operations, so it is not suitable for clinical and grassroots production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brucella diagnostic kit and use method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The preparation of embodiment 1 kit

[0029] This kit consists of at least two pairs of specific amplification primers, namely:

[0030] Inner primer FIP: gccatagccaaggtaaagaccggcggttgaagtagctcccca;

[0031] Internal primer BIP: cagcaccgttggcagcatcagatctggtcctgctggaagt;

[0032] Outer primer F3: gacgccatccaggaacag;

[0033] Outer primer B3: gcatcaccttcaacaccgtat;

[0034] The remaining materials in the kit can be solved by outsourcing.

Embodiment 2

[0035] Preferred kit of embodiment 2

[0036] The preferred kit of the present invention should consist of the following:

[0037] Two pairs of the aforementioned specific amplification primers, wherein the concentration of the outer primer is 5 pmol / μL, and the concentration of the inner primer is 20 pmol / μL; Bst DNA polymerase, the activity of Bst DNA polymerase is 8 active units / μL; Deoxyribonucleotide mixture; Buffer; Betaine; Magnesium sulfate; Chromogenic solution and positive control solution, specifically prepared as follows:

[0038] According to the primer sequence in Example 1, the oligodeoxynucleic acid primer was synthesized by a DNA synthesizer, and the concentration of the inner primer was 20 pmol / μL, and the concentration of the outer primer was 5 pmol / μL, and they were respectively packed in containers:

[0039] Purchase Bst DNA polymerase and place it in the container;

[0040] Purchase betaine, configure it at 5mol / L, and install it in containers;

[0041...

Embodiment 3

[0046] The application of embodiment 3 Brucella gene quick diagnostic kits of the present invention

[0047] 1. Sample processing (template DNA extraction)

[0048] Collect the sample to be tested according to the method in 2.4 of NY / T1467-2007, such as blood or emulsion;

[0049]According to the method in 2.5 of NY / T1467-2007, extract the nucleic acid of the sample to be tested to obtain the sample template, or use an equivalent commercial nucleic acid extraction kit to extract the DNA template of the sample to be tested according to the instructions.

[0050] 2. Loop-mediated amplification reaction process

[0051] (1) Reaction system: Add the following reagents into a 0.2ml thin-walled tube:

[0052] 10× Thermopol buffer 2.5 μL

[0053] Betaine 5.0 μL

[0054] 1.2 μL of deoxyribonucleotide mixture

[0055] 2.0 μL each of internal primers (FIP / BIP)

[0056] 1.0 μL each of outer primers (F3 / B3)

[0057] Magnesium sulfate 1.0 μL

[0058] Bst DNA polymerase 1.0 μL

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microbiological detection technology, in particular to a kit for diagnostic detection of Brucella and a use method of the kit. The Brucella detection kit of the invention at least comprises two pairs of specific amplification primers. The invention has the principle that by utilizing the loop-mediated isothermal amplification reaction (LAMP reaction for short), Bst DNA polymerase and two pairs of specific inner and outer primers (inner primers FIP / BIP and outer primers F3 / B3) designed according to a target gene sequence specifically recognize six independent regions on the target sequence, start cyclic chain displacement reaction and start complementary chain synthesis in the target DNA region, so that on the same chain, a complementary sequence cyclically forms a stem-loop DNA mixture with a plurality of loops and a cauliflower structure.

Description

technical field [0001] The invention relates to a microorganism detection technology, in particular to a kit for diagnosing Brucella and a method for using the kit. Background technique [0002] Brucellosis is a zoonotic infectious disease caused by Gram-negative, facultative intracellular bacteria of the genus Brucella. Many countries have reported outbreaks of brucellosis in humans and animals. Brucella has a wide host range and can infect more than 60 species of domestic animals, wild animals and marine mammals. After infection, it mainly causes damage to the reproductive system of animals, causes inflammation of the fetal membranes of pregnant female animals, leads to infertility, miscarriage, stillbirth, etc., and seriously endangers the development of animal husbandry and aquaculture. Humans often get infected due to contact with infected animals' milk, meat, fur and animal offal products, causing damage to bones and joints, nervous system, reproductive system, circu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 蔺国珍邱昌庆郑福英周继章曹小安宫晓炜
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More