Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mycobacterium tuberculosis detection kit and use method thereof

A technology of Mycobacterium tuberculosis and detection kit, which is applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problem of missing detection in the results, and achieve the effect of fast evolution rate

Active Publication Date: 2011-01-05
GUANGZHOU HUAFENG BIOTECH
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, using the repetitive factor insertion sequence 6110 as a broad diagnostic target sequence of Mycobacterium tuberculosis may cause the results to be missed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1 Preparation of kit

[0070] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0071] Outer primer F3: (SEQ ID NO 1)

[0072] ACCACGGAATACGACTTCGA

[0073] Outer primer B3: (SEQ ID NO 2)

[0074] AGTGAAAGGTGCGGCTCT

[0075] Inner primer FIP: (SEQ ID NO 3)

[0076] GGTCACCCTCTCGTCGGTCAttttGCAAGAGATGGCGTTCCTC

[0077] Inner primer BIP: (SEQ ID NO 4)

[0078] GAAGTGGTCAGCGACGTCGCttttTAACTTTGTGCGGTGCAGTG

[0079] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;

[0080] (3) Prepare the reaction solution: the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25mL TritonX-100, 1mol betaine, internal primer FIP per 1L / BIP each 2mol and outer primer F3 / B3 each 0.25mol, put in the container;

[0081] (4) Preparation of Lysis Solution 1: Lysis Solution 1 contains 0.1-0.2mol NaOH and 5-10mL Triton X-100 per 1L of Lysis ...

Embodiment 2

[0094] Example 2 Preparation of kit

[0095] The reaction solution contains 1.6mmol dNTP, 20mmol Tris-Cl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1mL TritonX-100, 0.8mol betaine, 1.6mol each of inner primer FIP / BIP and outer primer per 1L F3 / B3 each 0.2mol preparation, placed in the container.

[0096] Each 1L of lysis solution 3 contains 0.5-1mol Tris-HCl with pH 7.5.

[0097] The color developing fluid is EvaGreen.

[0098] Others are the same as in Example 1.

Embodiment 3

[0099] Example 3 Preparation of kit

[0100] The other conditions are the same as in Example 1. The only difference is that the primer in step (1) is:

[0101] Outer primer F3': (SEQ ID NO 5)

[0102] GGGTACGAGTGGTCTCAGG

[0103] Outer primer B3': (SEQ ID NO 6)

[0104] CGTCTTGGGTCACCCTCT

[0105] Inner primer FIP': (SEQ ID NO 7)

[0106] ACCGTTGACCCCGTCTTCTTGttttAGAAGTCGGAACCCCTGG

[0107] Inner primer BIP': (SEQ ID NO 8)

[0108] ATACGACTTCGAAACCGTCGCCttttGGTCAGCCCCTTGTTGAG.

[0109] In other embodiments of the present invention, other primers can be designed for the gyrB gene of the Mycobacterium tuberculosis complex according to the primer design principle of the LAMP technology.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a mycobacterium tuberculosis detection kit which comprises the following two pairs of primers: inner primers FIP / BIP and outer primers F3 / B3, wherein the two pairs of primer takes a gyrB gene of a mycobacterium tuberculosis composite group as a target gene and are designed on the basis of loop-mediated isothermal amplification (LAMP) technology. The mycobacterium tuberculosis detection kit has more comprehensive detection effect and low omission ratio.

Description

Technical field [0001] The invention relates to a biological detection reagent, in particular to a detection kit for Mycobacterium tuberculosis and a use method thereof. Background technique [0002] There are some problems in practical application of pathogenic nucleic acid detection technology represented by polymerase chain reaction (PCR) technology. For example, ordinary polymerase chain reaction (PCR) technology requires specialized instruments, and it is easy to cross-contamination and the operation process is cumbersome. Shortcomings. Although real-time quantitative polymerase chain reaction (real timePCR) technology can better solve the problem of cross-contamination and simplify the operation process, it requires more complex quantitative measurement equipment, so it is not suitable for on-site rapid detection. Moreover, the high cost of fluorescent probes in real-time quantitative polymerase chain reaction PCR technology increases the difficulty of popularization and a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 曹以诚赵雁林杜正平戴广明谭慧媚陈洵田文武冯雪梅柯佳佳尹斌
Owner GUANGZHOU HUAFENG BIOTECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More