Mycobacterium tuberculosis detection kit and use method thereof
A technology of Mycobacterium tuberculosis and detection kit, which is applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problem of missing detection in the results, and achieve the effect of fast evolution rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0069] Example 1 Preparation of kit
[0070] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0071] Outer primer F3: (SEQ ID NO 1)
[0072] ACCACGGAATACGACTTCGA
[0073] Outer primer B3: (SEQ ID NO 2)
[0074] AGTGAAAGGTGCGGCTCT
[0075] Inner primer FIP: (SEQ ID NO 3)
[0076] GGTCACCCTCTCGTCGGTCAttttGCAAGAGATGGCGTTCCTC
[0077] Inner primer BIP: (SEQ ID NO 4)
[0078] GAAGTGGTCAGCGACGTCGCttttTAACTTTGTGCGGTGCAGTG
[0079] (2) Purchase DNA polymerase: Bst DNA polymerase is placed in the container;
[0080] (3) Prepare the reaction solution: the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25mL TritonX-100, 1mol betaine, internal primer FIP per 1L / BIP each 2mol and outer primer F3 / B3 each 0.25mol, put in the container;
[0081] (4) Preparation of Lysis Solution 1: Lysis Solution 1 contains 0.1-0.2mol NaOH and 5-10mL Triton X-100 per 1L of Lysis ...
Embodiment 2
[0094] Example 2 Preparation of kit
[0095] The reaction solution contains 1.6mmol dNTP, 20mmol Tris-Cl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1mL TritonX-100, 0.8mol betaine, 1.6mol each of inner primer FIP / BIP and outer primer per 1L F3 / B3 each 0.2mol preparation, placed in the container.
[0096] Each 1L of lysis solution 3 contains 0.5-1mol Tris-HCl with pH 7.5.
[0097] The color developing fluid is EvaGreen.
[0098] Others are the same as in Example 1.
Embodiment 3
[0099] Example 3 Preparation of kit
[0100] The other conditions are the same as in Example 1. The only difference is that the primer in step (1) is:
[0101] Outer primer F3': (SEQ ID NO 5)
[0102] GGGTACGAGTGGTCTCAGG
[0103] Outer primer B3': (SEQ ID NO 6)
[0104] CGTCTTGGGTCACCCTCT
[0105] Inner primer FIP': (SEQ ID NO 7)
[0106] ACCGTTGACCCCGTCTTCTTGttttAGAAGTCGGAACCCCTGG
[0107] Inner primer BIP': (SEQ ID NO 8)
[0108] ATACGACTTCGAAACCGTCGCCttttGGTCAGCCCCTTGTTGAG.
[0109] In other embodiments of the present invention, other primers can be designed for the gyrB gene of the Mycobacterium tuberculosis complex according to the primer design principle of the LAMP technology.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap