Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof

A technology for rapid diagnosis of Legionella pneumophila, which is applied in the field of biological detection reagents, can solve the problems of no gene rapid diagnosis kit for detection of Legionella pneumophila, and achieves significant color difference, high yield, and low detection cost Effect

Active Publication Date: 2011-10-05
GUANGZHOU HUAFENG BIOTECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology. The established loop-mediated isothermal amplification technology (loop-mediated isothermal amplification of DNA, LAMP) has many advantages. There is no gene rapid diagnostic kit for detection of Legionella pneumophila using loop-mediated isothermal amplification technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof
  • Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof
  • Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The preparation of embodiment 1 kit

[0039] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0040]Outer primer F3: TCTATTGAAATAGCACTTAAGCT, as shown in SEQ ID NO: 1;

[0041] Outer primer B3: TGGATTCCGATCGGGATG, as shown in SEQ ID NO: 2;

[0042] Internal primer FIP: GCTGTTCCATAACTGCTCACAATTTttttAATTTAGAGTCTTCATACGACTGA, as shown in SEQ ID NO: 3;

[0043] Internal primer BIP: TTAGAAGTAAGTCGAAATGCGAGTGttttGTATTTCATTGCCAGCCTG, as shown in SEQ ID NO: 4;

[0044] (2) Purchase DNA polymerase: Bst DNA polymerase (large fragment) and place it in a container.

[0045] (3) Preparation of reaction solution: The formula of the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, 2 mol each of primers FIP / BIP and 0.25 mol each of outer primers F3 / B3 were prepared and placed in containers.

[0046] (4) Pre...

Embodiment 2

[0057] The preparation of embodiment 2 kit

[0058] The formula of the reaction solution is: each 1L reaction solution contains 1.6mmol dNTP, 20mmol Tris-HCl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, internal primer FIP / BIP each 1.6 mol and 0.2mol each of outer primer F3 / B3;

[0059] The formula of the sample pretreatment solution is: every 1L of the sample pretreatment solution contains 10mmol of Tris-HCl with pH8.0, 1mmol of EDTA and 10ml of Triton X-100.

[0060] The chromogenic solution is EvaGreen.

[0061] Others are the same as embodiment 1.

Embodiment 3

[0062] Example 3 Application of Legionella pneumophila Gene Rapid Diagnostic Kit

[0063] (1) Purpose of the experiment

[0064] The sensitivity, specificity and accuracy of the Legionella pneumophila LAMP gene rapid detection kit (Example 1) developed by Guangzhou Huafeng Biotechnology Co., Ltd. were evaluated.

[0065] (2) Selection of reference reagents

[0066] The routine reagents used in the daily detection of Guangzhou Center for Disease Control and Prevention, the Health Industry Standard of the People's Republic of China: Legionnaires' Disease Diagnostic Criteria and Treatment Principles WS 195--2001 were selected as the control.

[0067] The reagent for assessment was the Legionella pneumophila LAMP gene rapid detection kit developed by Guangzhou Huafeng Biotechnology Co., Ltd. (Example 1).

[0068] (3) Selection of research objects

[0069] Eight Legionella isolation cultures and two interfering strains provided by the Guangzhou Center for Disease Control and Pre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rapid diagnostic reagent kit of legionella pneumophilia genes based on a loop-mediated isothermal amplification technique and a detecting method thereof, wherein the reagent kit consists of two pairs of primers, DNA polymerase, a stable liquid, a reaction liquid, a sample pretreatment liquid, a color rendering liquid and a positive contrast liquid which are respectively placed in a container. The gene rapid diagnostic reagent kit can judge whether target substances exist or not by applying applies six sections and the four primers according amplification or non-amplification, and thereby has high specificity. The gene rapid diagnostic reagent kit has high speed, high efficiency and high sensitivity, only needs a constant temperature for amplification reaction without special reagents and equipment, and has low detection cost. The gene rapid diagnostic reagent kit has simple identification, can generate magnesium pyrophosphate deposits as a byproduct by combining pyrophosphate ions precipitated from dNTP and Mg<2> in a reaction solution, can identify the magnesium pyrophosphate deposits through visual study, and has remarkable color rendering difference of negative and positive results after the color rendering liquid is added, and is more marked and reliable.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a rapid diagnosis kit for Legionella pneumophila gene and a detection method thereof. Background technique [0002] At present, there are many detection methods for Legionella pneumophila, from the national standard (GB / T4789.7-2003) focusing on the isolation and identification of pathogenic microorganisms, morphological identification and automatic biochemical identification, to the immunological detection technology of specific proteins, Nucleic acid probes, polymerase chain reaction (PCR) technology and other molecular biological detection methods [Food Safety Testing and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try to break through the traditional microbiological detection modes such as morphology and biochemica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N21/82G01N21/78C12R1/01C12Q1/68
CPCY02A50/30
Inventor曹以诚陈洵杜正平谭慧媚邓小玲柯昌文李志勇李心晖
OwnerGUANGZHOU HUAFENG BIOTECH