78 results about "Legionella pneumophilia" patented technology

The invention discloses a kit for quickly detecting 15 pneumonia pathogenic bacteria. The kit can detect streptococcus pneumoniae, staphylococcus aureus, haemophilus influenzae, mycoplasma pneumoniae, pseudomonas aeruginosa, baumanii, enterococcus faecalis, enterococcus faecium, klebsiella pneumoniae, escherichia coli, enterobacter cloacae, stenotrophomonas maltophilia, burkholderia cepacia, legionella pneumophila and chlamydia pneumoniae which cover clinically common pneumonia pathogenic bacteria difficult to culture. 16S rDNA and specific gene sequences corresponding to the pneumonia pathogenic bacteria are detected by combining gene chips with multiple asymmetric PCR reactions, and the categories of the bacteria in a to-be-detected sample are identified in genus and species. The kit makes up for the defect that current clinical detection of pneumonia pathogenic bacteria is not in time or comprehensive and a novel detection means for early diagnosis and early treatment of patients suffering from pneumonia is provided.

This invention relates to a composition and method for treating Legionella Pneumophila comprising an electro-chemically activated anion-contained aqueous solution.

The invention relates to a method for detecting bacteria in drinking water and surface water, especially a method for simultaneous specific detection of bacteria from the Legionella species and the Legionella pneumophila species by in situ hybridization. The invention also relates to a method for specific detection of faecal streptococci by in situ-hybridization and a method for simultaneous specific detection of coliform bacteria and bacteria of the Escherichia coli species, in addition to corresponding oligonucleotide probes and kits enabling said inventive method to be carried out.

The invention provides a gene chip of main pathogenic microorganism in drinking water and a testing kit, which mainly aims at 11 kinds of bacteria of colibacillus / Shigella, salmonella, vibrio cholera, vibrio parahaemolyticus, staphylococcus aureus, enterococcus faecails, pseudomonas aeruginosa, legionella pneumophilia, pneumobacillus, yersinia enterocolitica and the like, and L.interrogans. The gene chip comprises a solid phase carrier and a oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe contains gyrB gene with tremendous evolutionary advantage, ITS gene and DNA segment selected from 16srRNA gene or complementary DNA segment. The gene chip and the testing kit of the invention can test the main pathogenic microorganism in drinking water, and has the characteristics of simple operation, high throughput, high accuracy, strong repeatability and the like, and can be used for clinical test for the water quality monitoring department.

Chromogenic 3-Indoxyl choline phosphate compounds of formula (I):wherein R is selected from the group consisting of hydrogen and C1-4 alkyl, such as methyl, ethyl, propyl and butyl while R<1>, R<2>, R<3>, and R<4 >are independently selected from the group consisting of hydrogen, halogen, cyano, nitro, carboxy, amino, amino substituted with one or two C1-4 alkyl groups, aminomethyl, hydroxy, C1-4 alkoxy, carboxyalkyl, and sulphonyl. These compounds are capable of being cleaved by lecithinase C leading to products which are calorimetrically detectable. The invention provides safe and sensitive detection of potentially pathogenic bacterial activity of such microbes as Clostridium perfringens, Bacillus cereus, Bacillus anthracis, Pseudomonas aeruginosa, Listeria monocytogenes, Heliobacter pylori, Legionella pneumophila, and others in material which may contain such activity typically including physiological samples, goods for consumption, such as food and beverages, and any other potentially infected objects or articles.

The invention discloses a legionnella rapid detecting and parting method, comprising the steps of: (1) extracting a genom DNA of a detecting sample, (2) performing PCR by using genom DNA as a template in order to acquire PCR products, (3) performing agarose gel electrophoresis analysis to the PCR products in order to determine if legionnella exists, (4) performing digestion reaction to the detected positive PCR products and then performing agarose gel electrophoresis analysis to the digestion reaction products and parting molecule. Compared with the prior art, the legionnella rapid detecting and parting method of the invention can rapidly and simply detect the legionnella and can part the molecule thereof into legionella pneumophilia and non-pneumophilia legionella.

The invention discloses a double-fluorescent PCR detection primer, a probe, reaction liquid and a kit capable of rapidly detecting 16 pathogens of the respiratory tract. The kit comprises pre-subpackaged PCR reaction liquid, RT-PCR enzyme, a positive quality control product and a negative quality control product, wherein the pre-subpackaged PCR reaction liquid is provided with a primer and a TaqMan probe for detecting at least two of the following pathogens: respiratory syncytial virus, enterovirus, coronavirus NL63, coronavirus HKU1, coronavirus 229E, coronavirus OC43, parainfluenza virus type I, parainfluenza virus type II, rhinovirus, parainfluenza virus type III, human bocavirus, human metapneumovirus, mycoplasma pneumoniae, chlamydia pneumoniae, adenovirus and legionella pneumophila. The kit is convenient to operate, and can be used for at most screening 16 syndrome pathogens of the respiratory tract within 2 hours, so that the detection time and cost are greatly saved. The kit has the greatest advantages of simplicity in operation and strong practicability, and can be easily popularized in laboratories of the ports.

An immune chromatographic test paper used for detecting antigen of legionella pneumophilia consists of sample pad, gold label pad of antibody label colloidal gold probe containing serum antigen resisting legionella pneumophilia, nitric acid fiber membrane and water absorption pad. It is featured as enveloping detection line containing antibody and quality control line containing anti-antibody on nitric acid fiber membrane and setting detection line to be separated from quality control line.

Provided are a method and a kit for accurately and rapidly detecting ten types of targeting pneumonia bacteria: Streptococcus pneumoniae, Haemophilus influenzae, Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, Klebsiella pneumoniae, Pseudomonas aeruginosa, Moraxella catarrhalis, methicillin-resistant Staphylococcus aureus (MRSA), and Staphylococcus aureus. A set of primer pairs directed to their respective target regions contained in the DnaJ gene, etc., of the ten types of pneumonia causative bacteria is designed for the ten bacterial strains and used to amplify gene products. A set of bacterial strain-specific probe pairs is further designed for the ten bacterial strains such that the probe pairs hybridize with the amplification products via sequences in the respective target regions differing from the sequences hybridized by the set of primer pairs. A first probe-bound labeled high molecular carrier in which plural types of first probes for the pneumonia bacteria are bound to a labeled high molecular carrier and a solid-phase second probe-carrying developing support are used as the set of probe pairs to perform nucleic acid chromatography.

The invention relates to a triple PCR (Polymerase Chain Reaction) detection method for rapidly distinguishing non-LP (legionella pneumophila), LP and LP I, which is a legionella multiple PCR detection method and belongs to the field of microorganism molecule detection. According to the invention, primers of 16SrRNA, danJ and ORF9 genes which respectively aim at legionella, LP and LP I are utilized to optimize a dNTPs and primer concentration ratio and an annealing temperature so as to establish the triple PCR detection method for rapidly distinguishing the non-LP (legionella pneumophila), the LP and the LP I. The method disclosed by the invention is simple, convenient and rapid, is low in cost, has an accurate and reliable result and can rapidly and effectively judge dubious legionella strains cultured by separation.

A method for detecting and enumerating viable microorganisms in a sample suspected of containing said microorganisms (1) contacting said microorganisms of said sample with at least one repair compound and a growth medium, and (2) incubating the product of steps (1), and (3) detecting and quantifying said viable microorganisms, in which the microorganisms are of the species Legionella pneumophila, and in which the repair compound directly or indirectly causes an effect on the metabolism to reduce the oxidative stress of the microorganism. The invention also includes a kit for more accurately detecting and enumerating viable microorganisms of the species Legionella pneumophila in a sample suspected of containing said microorganisms.

The present invention provides a genotyping chip for legionella pneumophila, and a kit for detection of the legionella pneumophila. The chip and the kit are mainly provided according to the 11 serotypes of the legionella pneumophila, wherein the 11 serotypes comprise O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and O15. The gene chip comprises a solid phase carrier and oligonucleotide probes fixed on the solid phase carrier, wherein the oligonucleotide probes comprise DNA fragments selected from wzm gene, wzt gene and wecA gene, or complementary DNA fragments of the wzm gene, the wzt gene and the wecA gene, wherein the wzm gene, the wzt gene and the wecA gene have significant biological evolution advantages. According to the present invention, the genomic DNA of the sample requiring detection is amplified by the designed primers; the resulting amplified genomic DNA is labeled; the resulting labeled genomic DNA is subjected to hybridization with the gene chip; according to the resulting hybridization signals, the different serotypes of the legionella pneumophila can be detected. With the gene chip of the present invention, the purpose of the detection of the serotypes of the legionella pneumophila can be achieved, the operation is convenient, the accuracy is high, the repeatability is strong, and the accurate medical medication guidance is provided.

The object of the invention is to provide a water-circulating sterilizer that uses no chlorine-base bactericidal agents, has no effect on the human body with no change of water quality, with no running cost and completely free from maintenance while effective sterilization is possible within shorter time.The invention provides a water-circulating sterilizer disposed in a pipeline of circulating water for sterilizing Legionella pneumophila surviving in circulating water, wherein plural sets of a first, second and third alloy plates are sequentially disposed from a water inflow port, the first alloy plate comprises an alloy containing at least copper and tin, the second alloy plate comprises an alloy containing at least silicon and titanium, and the third alloy plate comprises an alloy containing at least iron, molybdenum and manganese.

The invention provides a multiple quantitative PCR (polymerase chain reaction) kit for quick combined detection of four bacteria difficult to cultivate and identify. The multiple quantitative PCR kit comprises four PCR reaction systems, wherein the four PCR reaction systems comprise AllGlo fluorescence probes and forward and reverse primers aimed at the following four pathogens which cause child bacterial pneumonia and are clinically difficult to cultivate and identify: haemophilus influenza, streptococcus pneumonia, moraxella catarrhalis and legionella pneumophila. According to the multiple quantitative PCR kit, the design is reasonable, the infection of the four pathogens, clinically difficult to cultivate and identify, of child bacterial pneumonia can be easily, conveniently, quickly and parallelly detected in a reaction tube at the same time, the situation that four bacteria are detected at the same time through single-tube PCR is achieved, quantitative detection is achieved, the kit is easy and quick to operate, high in sensitivity, good in specificity and repeatability, accurate and reliable in result, early specific diagnosis, prevention and treatment can be provided for patients suffering from infantile pneumonia according to the bacterial infection titer, and the kit has great clinical practicability for interdicting an infection source, reducing infection or mixed infection of the four bacteria and monitoring the clinical curative effect.

The invention discloses a detection kit and a detection method for I-form legionella pneumophila. The detection kit comprises a PCR (polymerase chain reaction) reaction liquid, wherein the PCR reaction liquid comprises first reaction liquid and second reaction liquid which are separated from each other, and the second reaction liquid contains enzyme; the first reaction liquid contains a primer probe for carrying out fluorescent quantitation PCR on target genes of I-form legionella pneumophila. The detection method comprises the steps of extracting DNA of a to-be-detected sample, carrying out real-time fluorescent PCR and comparing and judging a fluorescence signal detection result with a control group. According to the detection kit, the first reaction liquid containing the primer probe of the I-form legionella pneumophila and the second reaction liquid containing enzyme can be directly mixed to carry out real-time fluorescent PCR, so that the I-form legionella pneumophila can be rapidly detected; furthermore, the pollution is avoided, and the sensitivity is high.

The invention relates to a primer for amplifying the gene specific area of a DNA gyrase B subunit gene (gyrB for short) in legionella pneumophilia and provides a polymerase chain reaction (PCR) kit which comprises the primer for amplifying the gene specific area of the gyrB in the legionella pneumophilia. The PCR kit is simple, convenient and rapid and has high specificity and sensitivity when used for detecting the legionella pneumophilia, can be applied to the fields such as the supervision and detection of water bodies and clinical samples, the detection of pathogenic bacteria in drinking water, bacteriology classification, the investigation of epidemiology and the like and has good social benefit and economic benefit.

A combined electrochemical system for scale treatment and eradicating bacteria in water supply systems having: (a) a first electro-chemical cell including: (i) a first metallic tank for receiving a water supply and forming a cathode of the first electro-chemical cell, and (ii) a first anode, disposed within the first tank; (b) a second electro-chemical cell including: (i) a second metallic tank for receiving an effluent from the first tank and forming a cathode of the second electro-chemical cell, and (ii) a second anode, disposed within the second tank; and (c) a DC electrical supply source operatively connected to the first and the second cells, wherein the first electro-chemical cell is operative for trapping bacteria in a colloid-like structure, and the second electro-chemical cell is operative for producing a pH above 12 near the walls of the second tank, so as to form a bacteria-containing precipitate on the walls of the second tank, thereby removing the bacteria from the water supply.

The invention relates to an appraising method for legionella pneumophilia biochemical reaction. The invention comprises four steps of tests: hippurate hydrolyzing test, nitrate deacidizing test, urease test and gelatin liquefaction test. The key technique is that an L-cysteine is respectively added into the culture medium of the hippurate hydrolyzing test, the nitrate deacidizing test, the urease test and the gelatin liquefaction test of the biochemical reaction. The invention can be applied to appraising legionella pneumophilia of the environmental water, air-conditioning cooling water, condensate water, phlegm, gas pipe suction liquid, lung tissue, etc. The invention can be applied to disease prevention and control system, Entry-Exit Quarantine Bureau, technical supervision department, environmental protection, hospital and other industries. The invention has the advantages of simple technique, easy operation, fast testing speed and high efficiency. The invention provides a novel scientific method for quickly detecting and appraising legionella pneumophilia.

The invention provides a genetic typing chip and a detection kit of 10 common pathogenic legionella (legionella pneumophila, legionellaanisa, legionella bozemanii, legionella dumoffii, legionella fairfieldensis, legionella gormanii, legionellajordanis, legionella longbeachae, legionella maceachernii, legionella maceachernii and the like). The genetic chip comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier. The oligonucleotide probe comprises a DNA (deoxyribonucleic acid) fragment or a complementary DNA fragment selected on a 16s-23s intermediate zone sequence (ITS). Genomic DNA of a sample to be detected is amplified and labeled by a designed primer and is hybridized by the genetic chip, and legionella in different types can be detected according to hybridizing signals. The genetic chip can detect common pathogenic legionella and is simple and convenient to operate, high in accuracy and strong in repeatability, and guide medical administration more accurately.

The invention discloses a rapid-recognition gene chip for pathogenic bacteria of pneumonia. The gene chip can detect 15 pathogenic bacteria including streptococcus pneumoniae, staphylococcus aureus, haemophilus influenzae, mycoplasma pneumoniae, pseudomonas aeruginosa, acinetobacter baumannii, enterococcus faecalis, enterococcus faecium, klebsiella pneumoniae, escherichia coli, enterobacter cloacae, stenotrophomonas maltophilia, burkholderia cepacia, legionella pneumophila and chlamydia pneumoniae, and clinically common and difficult-to-culture pathogenic bacteria are contained. In a preparation process of the gene chip, design, screening and verification of probes are performed by adopting 16S rDNA and a specific gene sequence corresponding to each of the pathogenic bacteria, and types of the bacteria in a to-be-detected sample are identified from levels of genus and species simultaneously and respectively. The gene chip has the advantages that the defect that clinical detection of the pathogenic bacteria of pneumonia is not timely and comprehensive at present is overcome, and one novel detection way is provided for early diagnosis and early treatment of patients with pneumonia.

The invention discloses a detection method for distinguishing non-pneumophilia legionella and legionella pneumophilia and a kit. The method detects legionella and legionella pneumophilia through single tube amplification of multi-wavelength fluorescent polymerase chain reaction (PCR) technology of a TaqMan probe by adopting a legionella target sequence SEQ ID No.1 design-based primer probe, and distinguishes the non-pneumophilia legionella and the legionella pneumophilia according to the result; and meanwhile, an artificially constructed internal reference system for avoiding false negative detection results is also adopted in the kit. The kit comprises nucleic acid extract, PCR buffer solution, a fluorescent probe, Taq enzyme, an internal reference, and negative and positive contrasts; and two steps comprising sample treatment and amplification detection are used in the kit. The kit is simple and convenient to operate, has high sensitivity, can avoid false positive generated by nucleic acid pollution of PCR products, can solve the problem of false negative caused by a PCR inhibitor in the sample, and can be widely applied to disease control and quick detection of the legionella and the legionella pneumophilia in clinic.

An immune chromatographic test paper used for detecting antibody of legionella pneumophilia consists of sample pad, gold label pad containing A label colloidal gold probe of staphylococcus aureus protein, nitric acid fiber membrane and water absorption pad. It is featured as enveloping detection line containing antigen and quality control line containing antibody on nitric acid fiber membrane and setting said detection line to be separated from said quality control line.

The invention discloses a rapid diagnostic reagent kit of legionella pneumophilia genes based on a loop-mediated isothermal amplification technique and a detecting method thereof, wherein the reagentkit consists of two pairs of primers, DNA polymerase, a stable liquid, a reaction liquid, a sample pretreatment liquid, a color rendering liquid and a positive contrast liquid which are respectively placed in a container. The gene rapid diagnostic reagent kit can judge whether target substances exist or not by applying applies six sections and the four primers according amplification or non-amplification, and thereby has high specificity. The gene rapid diagnostic reagent kit has high speed, high efficiency and high sensitivity, only needs a constant temperature for amplification reaction without special reagents and equipment, and has low detection cost. The gene rapid diagnostic reagent kit has simple identification, can generate magnesium pyrophosphate deposits as a byproduct by combining pyrophosphate ions precipitated from dNTP and Mg<2+> in a reaction solution, can identify the magnesium pyrophosphate deposits through visual study, and has remarkable color rendering difference ofnegative and positive results after the color rendering liquid is added, and is more marked and reliable.

The invention relates to a nucleotide specific to wzt of Legionella pneumophila serogroup 1 and application thereof. The nucleotide is a nucleotide shown as SEQ ID NO: 1 and / or a nucleotide shown as SEQ ID NO: 2 and is complementary with the nucleotides. The nucleotides can be used for preparing a PCR (Polymerase Chain Reaction) kit for detecting Legionella pneumophila serogroup 1, a gene chip or a micro-array. The nucleotide specific to the wzt of the Legionella pneumophila serogroup 1 provided by the invention as well as the PCR kit, the gene chip or the micro-array including the nucleotide have the advantages of strong practical applicability, simple preparation method of the PCR kit, short detection period, high speed, strong maneuverability, easiness for industrial production, low detection cost, high accuracy and high sensitivity.

The invention provides a primer group for multiple RPA detection of respiratory tract pathogens, a detection reagent and a kit. The high-specificity primer group for multiple RPA detection is successfully obtained through RPA primer design improvement of at least 5 respiratory tract pathogens of human cytomegalovirus, adenovirus, parainfluenza virus 1, parainfluenza virus 2, parainfluenza virus 3,respiratory syncytial virus, staphylococcus aureus, streptococcus pneumoniae, mycoplasma pneumoniae, chlamydia pneumoniae, klebsiella pneumoniae, acinetobacter baumannii, pseudomonas aeruginosa, stenotrophomonas maltophilia and legionella pneumophila, the detection reagent is prepared with the adoption of the primer group, and the kit is prepared, so that RPA detection of up to 15 respiratory tract pathogens can be realized according to speculation, time required for the whole detection procedure can be shortened, and steps are simplified.

The present application describes compositions and methods useful for the rapid detection of Legionella pneumophila. The compositions include capture probes, amplification primers, primer sets and detection probes that comprise nucleic acid molecules that hybridize to L. pneumophila 23S rRNA or DNA encoding 23S rRNA target sequences. Also described are methods for detecting and / or quantifying the amount of L. pneumophila in a sample using real time PCR (rPCR) or revere transcriptase real time PCR (RT-rPCR).

A method for specific detection of the presence of Legionella pneumophila in a sample that is suspected to contain L. pneumophila and which further comprises one or more other microorganism(s).

The invention relates to a legionella pneumophilia test kit, in particular to a fast test kit of legionella pneumophilia in a drinking water system and application thereof, belonging to the technical field of molecule test. The legionella pneumophilia test kit comprises the following primers: external primers including a Primer F2: 5'TGCAAGACGCTATGAGTGGCGC 3' and a Primer R2: 5'TCCCAAGTTGATCCAGCGGGCA 3'; and internal primers including a Primer F1: 5'TGAGTGGCGCTCAATTGGCT 3' and a Primer R1: 5'AACCTGGAACGTTGCTGGCT 3'. Aiming at the characteristic of low concentration of legionella pneumophilia in the drinking water system, the legionella pneumophilia test kit provided by the invention adopts high-specificity primers and a midway advance and retreat nest type PCR (Ploymerase Chain Reaction) amplification technology to realize high specificity and sensitivity of test.