Supercharge Your Innovation With Domain-Expert AI Agents!

Legionella pneumophilia test kit and application thereof

A detection kit, a technology for Legionella pneumophila, applied in the determination/inspection of microorganisms, biochemical equipment and methods, resistance to vector-borne diseases, etc., can solve the problem of low homology of mip genes, no advantage in detection time, and preparation The method is cumbersome and other problems, to achieve the effect of simple detection steps, saving detection time, and simple preparation

Inactive Publication Date: 2011-07-27
SHANDONG UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The mip genes present in various strains of Legionella pneumophila have high homology (generally ≥98%), and in recent years have also been found in some non-pneumophila Legionella, such as Legionella anisa, Legionella anisa, The mip gene also exists in Streptococcus, Tatlockia micdadei, etc., but has relatively low homology with the mip gene of Legionella pneumophila
[0004] However, there are the following problems in the practical application of PCR technology in the detection of Legionella: (1) The routine operation is cumbersome, especially the preparation method of the amplification template is cumbersome; (2) The specificity is not high enough, and the detection of similar genera will produce false positive results. Positive; (3) Compared with the rapid immunological detection method, the conventional detection time has no advantage, and the detection time needs more than 4 hours

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Legionella pneumophilia test kit and application thereof
  • Legionella pneumophilia test kit and application thereof
  • Legionella pneumophilia test kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] A Legionella pneumophila detection kit is characterized in that it contains the following primers:

[0047] Outer primers:

[0048] Primer F2: 5'TGCAAGACGCTATGAGTGGCGC 3'

[0049]Primer R2: 5'TCCCAAGTTGATCCAGCGGGCA 3'

[0050] Inner primer:

[0051] Primer F1: 5'TGAGTGGCGCTCAATTGGCT 3'

[0052] Primer R1: 5'AACCTGGAACGTTGCTGGCT 3';

[0053] The PCR reaction solution (2×) was prepared by double distilled water, and its component concentration was:

[0054] Taq DNA polymerase 0.1U / μL

[0055] dNTP mixture (dATP, dGTP, dCTP, dTTP) 0.4mmol / L

[0056] MgCl 2 3mmol / L

[0057] KCl 100mmol / L

[0058] Tris-HCl (pH8.3) 20mmol / L

[0059] Upstream inner primer (Primer F1) 0.16μmol / L

[0060] Downstream inner primer (Primer R1) 0.16μmol / L

[0061] (Inconsistent with the scope in the content of the invention, please modify)

[0062] Upstream outer primer (Primer F2) 1.2μmol / L

[0063] Downstream outer primer (Primer R2) 1.2 μmol / L.

Embodiment 2

[0065] The application of the Legionella pneumophila detection kit in the detection of drinking water, the steps are as follows:

[0066] 1. Water sample concentration and bacterial sample collection

[0067] Take a 5L volume of water sample and collect the bacterial sample through a 0.22μm filter membrane. During the filtration process, the filter membrane can be replaced depending on the amount of water sample, that is, the turbidity of the water sample; Distill 5mL of water. If there are multiple filter membranes, put two into one tube, vortex for 10 seconds; remove the filter membrane, combine the eluent, centrifuge at 12000rpm for 1 minute, discard the supernatant, and keep the precipitate.

[0068] 2. Template Preparation

[0069] Suspend and mix the obtained precipitate with 1-2 mL double distilled water, transfer to a 1.5 or 2 mL centrifuge tube, centrifuge at 12000 rpm for 1 minute, discard the supernatant, and keep the precipitate; repeat the above steps once; final...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a legionella pneumophilia test kit, in particular to a fast test kit of legionella pneumophilia in a drinking water system and application thereof, belonging to the technical field of molecule test. The legionella pneumophilia test kit comprises the following primers: external primers including a Primer F2: 5'TGCAAGACGCTATGAGTGGCGC 3' and a Primer R2: 5'TCCCAAGTTGATCCAGCGGGCA 3'; and internal primers including a Primer F1: 5'TGAGTGGCGCTCAATTGGCT 3' and a Primer R1: 5'AACCTGGAACGTTGCTGGCT 3'. Aiming at the characteristic of low concentration of legionella pneumophilia in the drinking water system, the legionella pneumophilia test kit provided by the invention adopts high-specificity primers and a midway advance and retreat nest type PCR (Ploymerase Chain Reaction) amplification technology to realize high specificity and sensitivity of test.

Description

technical field [0001] The invention relates to a kit for detecting Legionella pneumophila, in particular to a kit for rapid detection of Legionella pneumophila in a drinking water supply system and an application thereof, belonging to the technical field of molecular detection. Background technique [0002] The detection methods of Legionella pneumophila in the drinking water supply system mainly include the following categories: one is the morphological and biochemical identification detection technology based on bacterial culture, represented by the national standard GB / T4789.7-2003; the other is immunological detection Technology, including serum specific antibody detection method, urine antigen detection method, etc.; the third is molecular biology detection technology, including nucleic acid probe and PCR detection technology (Liu Guanghua et al., Experimental diagnostic methods and research progress of Legionella. Chinese Experimental Diagnostics [J], 2006(10): 427-42...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCY02A50/30
Inventor 李力贾瑞宝
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More