Legionella pneumophilia test kit and application thereof
A detection kit, a technology for Legionella pneumophila, applied in the determination/inspection of microorganisms, biochemical equipment and methods, resistance to vector-borne diseases, etc., can solve the problem of low homology of mip genes, no advantage in detection time, and preparation The method is cumbersome and other problems, to achieve the effect of simple detection steps, saving detection time, and simple preparation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] A Legionella pneumophila detection kit is characterized in that it contains the following primers:
[0047] Outer primers:
[0048] Primer F2: 5'TGCAAGACGCTATGAGTGGCGC 3'
[0049]Primer R2: 5'TCCCAAGTTGATCCAGCGGGCA 3'
[0050] Inner primer:
[0051] Primer F1: 5'TGAGTGGCGCTCAATTGGCT 3'
[0052] Primer R1: 5'AACCTGGAACGTTGCTGGCT 3';
[0053] The PCR reaction solution (2×) was prepared by double distilled water, and its component concentration was:
[0054] Taq DNA polymerase 0.1U / μL
[0055] dNTP mixture (dATP, dGTP, dCTP, dTTP) 0.4mmol / L
[0056] MgCl 2 3mmol / L
[0057] KCl 100mmol / L
[0058] Tris-HCl (pH8.3) 20mmol / L
[0059] Upstream inner primer (Primer F1) 0.16μmol / L
[0060] Downstream inner primer (Primer R1) 0.16μmol / L
[0061] (Inconsistent with the scope in the content of the invention, please modify)
[0062] Upstream outer primer (Primer F2) 1.2μmol / L
[0063] Downstream outer primer (Primer R2) 1.2 μmol / L.
Embodiment 2
[0065] The application of the Legionella pneumophila detection kit in the detection of drinking water, the steps are as follows:
[0066] 1. Water sample concentration and bacterial sample collection
[0067] Take a 5L volume of water sample and collect the bacterial sample through a 0.22μm filter membrane. During the filtration process, the filter membrane can be replaced depending on the amount of water sample, that is, the turbidity of the water sample; Distill 5mL of water. If there are multiple filter membranes, put two into one tube, vortex for 10 seconds; remove the filter membrane, combine the eluent, centrifuge at 12000rpm for 1 minute, discard the supernatant, and keep the precipitate.
[0068] 2. Template Preparation
[0069] Suspend and mix the obtained precipitate with 1-2 mL double distilled water, transfer to a 1.5 or 2 mL centrifuge tube, centrifuge at 12000 rpm for 1 minute, discard the supernatant, and keep the precipitate; repeat the above steps once; final...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap