Unlock instant, AI-driven research and patent intelligence for your innovation.

Mycobacterium detection kit and application method thereof

A technology for detection kits and mycobacteria, applied in the direction of microorganism-based methods, biochemical equipment and methods, and microorganism measurement/testing, can solve problems such as insufficient accuracy, complicated procedures, and long detection cycles, and achieve maintenance Complete sealing, reduce pollution effect

Active Publication Date: 2013-12-18
GUANGZHOU HUAFENG BIOTECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Traditional mycobacteria detection methods are far from meeting modern detection requirements due to their shortcomings such as long detection cycle, complicated procedures, and various reagents required.
The pathogenic nucleic acid detection technology represented by polymerase chain reaction (PCR) technology has some problems in practical application, such as ordinary polymerase chain reaction (PCR) technology requires special instruments, and there are easy cross-contamination and cumbersome operation process Shortcomings
Although the fluorescent real-time quantitative polymerase chain reaction (realtimePCR) technology solves the problem of cross-contamination and simplifies the operation process, it requires more complex quantitative measurement instruments, so it is not suitable for on-site rapid detection
Moreover, the cost of fluorescent probes in real-time quantitative polymerase chain reaction PCR technology is relatively high, which increases the difficulty of popularization and application.
Immunological detection technology is fast, simple and low-cost, but requires high-quality and high-stability monoclonal antibodies. Otherwise, due to insufficient accuracy, it can only be used as an auxiliary detection method at present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycobacterium detection kit and application method thereof
  • Mycobacterium detection kit and application method thereof
  • Mycobacterium detection kit and application method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] The preparation of embodiment 1 kit

[0078] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0079] Outer primer F3: (SEQ ID NO1)

[0080] TCATCACCGTCGAGGAGTC

[0081] Outer primer B3: (SEQ ID NO2)

[0082] CGGCTCCGATGACCTTCTC

[0083] Internal primer FIP: (SEQ ID NO3)

[0084] GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC

[0085] Internal primer BIP: (SEQ ID NO4)

[0086] AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG

[0087] (V stands for A / C / G)

[0088] (2) Purchase DNA polymerase: BstDNA polymerase is placed in the container;

[0089] (3) Prepare the reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / LTris-Cl, 12.5mmol / LKCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / LMgSO 4 , 0.125% by volume TritonX-100, 1mol / L betaine, each 0.2 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3, placed in the container;

[0090] (4) Prepare the sample pretreatment solution: th...

Embodiment 2

[0101] The preparation of embodiment 2 kit

[0102] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0103] Outer primer F3: (SEQ ID NO1)

[0104] TCATCACCGTCGAGGAGTC

[0105] Outer primer B3: (SEQ ID NO2)

[0106] CGGCTCCGATGACCTTCTC

[0107] Internal primer FIP: (SEQ ID NO3)

[0108] GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC

[0109] Internal primer BIP: (SEQ ID NO4)

[0110] AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG

[0111] (V stands for A / C / G)

[0112] (2) Purchase DNA polymerase: BstDNA polymerase is placed in the container;

[0113] (3) Prepare the reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / L Tris-Cl, 10mmol / LKCl, 10mmol / L (NH 4 ) 2 SO 4 , 8mmol / LMgSO 4 , 0.1 volume % TritonX-100, 0.8 mol / L betaine, each 0.2 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3 are placed in the container;

[0114] (4) Prepare the sample pretreatment solution: th...

Embodiment 3

[0120] The preparation of embodiment 3 kits

[0121] Other conditions are the same as in Example 1, the only difference being that the primers in step (1) are:

[0122] Outer primer F3': (SEQ ID NO5)

[0123] AGTCCATCGGTGACCTGATC

[0124] Outer primer B3': (SEQ ID NO6)

[0125] AGGACCGCCTCCTGAC

[0126] Internal primer FIP': (SEQ ID NO7)

[0127] GGTGTTGGACTCCTCGACGGGCCGAGGCGATGGACAA

[0128] Internal primer BIP': (SEQ ID NO8)

[0129] GCAGCTCGAGCTCACCGAGCGGGTCGGTCACGAAGT

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a mycobacterium detection kit. The mycobacterium detection kit comprises two pairs of primers, including inner primers FIP / BIP and F3 / B3, wherein the two pairs of primers take hsp65 genes of mycobacterium as target genes and are designed on the basis of a loop-mediated isothermal amplification technique. The mycobacterium detection kit disclosed by the invention is more comprehensive in detection efficiency and low in undetected rate.

Description

[0001] This application is a divisional application with filing date: September 19, 2012, application number: 201210352230.5, title of invention: Mycobacterium detection kit and its usage method. technical field [0002] The invention relates to a biological detection reagent, in particular to a mycobacterium detection kit and a use method thereof. Background technique [0003] Mycobacterium (Mycobacterium) is a kind of slender and slightly curved bacillus, which has the tendency of branching growth, hence the name. There are many types of bacteria in this genus, which can be divided into three types: Mycobacterium tuberculosis complex, non-tuberculous mycobacteria and Mycobacterium leprae. [0004] Mycobacterium tuberculosis (M.tuberculosis), commonly known as Mycobacterium tuberculosis or Mycobacterium tuberculosis, is the pathogenic bacteria that causes tuberculosis. Tuberculosis is a major infectious disease that threatens human and animal health. The World Health Orga...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/32
CPCC12Q1/689C12Q2600/16
Inventor 曹以诚茅莉娜陈振柳杜正平王静吕冰凌
Owner GUANGZHOU HUAFENG BIOTECH