Mycobacterium detection kit and application method thereof
A technology for detection kits and mycobacteria, applied in the direction of microorganism-based methods, biochemical equipment and methods, and microorganism measurement/testing, can solve problems such as insufficient accuracy, complicated procedures, and long detection cycles, and achieve maintenance Complete sealing, reduce pollution effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0077] The preparation of embodiment 1 kit
[0078] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0079] Outer primer F3: (SEQ ID NO1)
[0080] TCATCACCGTCGAGGAGTC
[0081] Outer primer B3: (SEQ ID NO2)
[0082] CGGCTCCGATGACCTTCTC
[0083] Internal primer FIP: (SEQ ID NO3)
[0084] GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC
[0085] Internal primer BIP: (SEQ ID NO4)
[0086] AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG
[0087] (V stands for A / C / G)
[0088] (2) Purchase DNA polymerase: BstDNA polymerase is placed in the container;
[0089] (3) Prepare the reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / LTris-Cl, 12.5mmol / LKCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / LMgSO 4 , 0.125% by volume TritonX-100, 1mol / L betaine, each 0.2 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3, placed in the container;
[0090] (4) Prepare the sample pretreatment solution: th...
Embodiment 2
[0101] The preparation of embodiment 2 kit
[0102] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0103] Outer primer F3: (SEQ ID NO1)
[0104] TCATCACCGTCGAGGAGTC
[0105] Outer primer B3: (SEQ ID NO2)
[0106] CGGCTCCGATGACCTTCTC
[0107] Internal primer FIP: (SEQ ID NO3)
[0108] GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC
[0109] Internal primer BIP: (SEQ ID NO4)
[0110] AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG
[0111] (V stands for A / C / G)
[0112] (2) Purchase DNA polymerase: BstDNA polymerase is placed in the container;
[0113] (3) Prepare the reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / L Tris-Cl, 10mmol / LKCl, 10mmol / L (NH 4 ) 2 SO 4 , 8mmol / LMgSO 4 , 0.1 volume % TritonX-100, 0.8 mol / L betaine, each 0.2 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3 are placed in the container;
[0114] (4) Prepare the sample pretreatment solution: th...
Embodiment 3
[0120] The preparation of embodiment 3 kits
[0121] Other conditions are the same as in Example 1, the only difference being that the primers in step (1) are:
[0122] Outer primer F3': (SEQ ID NO5)
[0123] AGTCCATCGGTGACCTGATC
[0124] Outer primer B3': (SEQ ID NO6)
[0125] AGGACCGCCTCCTGAC
[0126] Internal primer FIP': (SEQ ID NO7)
[0127] GGTGTTGGACTCCTCGACGGGCCGAGGCGATGGACAA
[0128] Internal primer BIP': (SEQ ID NO8)
[0129] GCAGCTCGAGCTCACCGAGCGGGTCGGTCACGAAGT
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com