Check patentability & draft patents in minutes with Patsnap Eureka AI!

Rapid diagnosis reagent kit and detection method for vibrio vulnficus gene

A technology for rapid diagnosis of Vibrio vulnificus, applied in biochemical equipment and methods, measurement/inspection of microorganisms, resistance to vector-borne diseases, etc., to achieve high verification rate, simple identification, and high yield

Active Publication Date: 2011-08-24
GUANGZHOU HUAFENG BIOTECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology, and the established loop-mediated isothermal amplification technology (loop-mediated isothermal amplification of DNA, LAMP) has many advantages. and there is currently no gene rapid diagnostic kit for detection of Vibrio vulnificus using loop-mediated isothermal amplification technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Preparation of Example 1 Kit

[0036] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0037] Outer primer F3: TGAGAACGGTGACAAAACGG;

[0038] Outer primer B3: GAGCTTATCGCCTTCCCAAT;

[0039] Inner primer FIP: AGGCCCCAAACTTGGTTCCAATTTTTTGCGGGTGGTTCGGTTA;

[0040] Inner primer BIP:

[0041] AGCCGAGTRGCATCCGATCGTTTTGCTAAGTTCGCACCACACT;

[0042] (2) Purchase DNA polymerase: BstDNA polymerase (large fragment), and place it in a container.

[0043](3) prepare reaction solution: the formula of reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, internal The primers FIP / BIP were each prepared by 2 mol and the outer primers F3 / B3 were each 0.25 mol, and placed in a container.

[0044] (4) Preparation of sample pretreatment solution: The formula of sample pretreatment solution is prepared by containing 2...

Embodiment 2

[0055] Example 2 Preparation of the kit

[0056] The formula of the reaction solution is: each 1L reaction solution contains 1.6 mmol dNTP, 20 mmol Tris-HCl, 10 mmol potassium chloride, 10 mmol ammonium sulfate, 8 mmol magnesium sulfate, 1 ml TritonX-100, 0.8 mol betaine, and 1.6 1.6 each of inner primer FIP / BIP. mol and outer primer F3 / B3 each 0.2mol;

[0057] The formula of the sample pretreatment solution is as follows: each 1L of the sample pretreatment solution contains 10 mmol pH8.0 Tris-HCl, 1 mmol EDTA and 10 ml Triton X-100.

[0058] The developer solution is EvaGreen.

[0059] Others are the same as in Example 1.

Embodiment 3

[0060] Example 3 Application of Vibrio vulnificus gene rapid diagnostic kit

[0061] 1. Sample processing (template DNA extraction)

[0062] (1) Take about 200ml of water sample (or sediment, ooze, etc.) using aseptic operation technology. If there is any impurity, it can be left to settle or centrifuged at 1000r / min for 1min to remove large particles;

[0063] (2) Filter the precipitated or centrifuged sample (supernatant) through a filter membrane with a pore size of 0.22 μm to 0.45 μm, remove the filter membrane and place it in 15 ml of sterile water to fully elute;

[0064] (3) Take 5ml of elution sample, centrifuge at 10000rpm for 2min to obtain bacterial cell precipitation;

[0065] (4) Add 100 μl of sample pretreatment solution to the above bacterial cell precipitation, mix well, boil in boiling water for 10 minutes, then place on ice for 10 minutes, centrifuge at 10,000 rpm for 2 minutes, and the supernatant is the sample template DNA.

[0066] 2. The reaction proces...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rapid diagnosis kit and a detection method of genes of vibrio vulnificus. The kit consists of two pairs of primers, DNA polymerase, stabilizing solution, reaction solution, sample pre-treatment solution, color development solution and positive comparison solution, wherein, the seven solutions are respectively placed in containers. The rapid diagnosis kit of genes of the invention applies six sections and four primers and can judge whether target materials exist only according to the amplification, thus being high in specificity. The rapid diagnosis kit of genes of the invention is high in speed, high in efficiency and sensitivity, can amplify the reaction with only constant temperature, without special reagents or equipment, and is low in detection cost. The rapid diagnosis kit of genes of the invention is simple and convenient in identification. Pyrophosphate ions separated out from the dNTP are combined with Mg<2+> in the reaction solution to produce a by-product which is the sediment of magnesium pyrophosphate which can be identified by naked eyes. Furthermore, after the color development solution is added, the color development differences of negative and positive results are notable and the identification is more obvious and reliable.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a rapid diagnosis kit of Vibrio vulnificus gene and a detection method thereof. Background technique [0002] At present, there are many detection methods for Vibrio vulnificus, ranging from isolation and identification of pathogenic microorganisms, morphological identification and automatic biochemical identification, to immunological detection technology of specific proteins, nucleic acid probes, polymerase chain reaction (PCR) technology and other molecules. Biological detection methods [Food Safety Testing and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try to break through the traditional microbiological detection modes such as morphology and biochemical reactions, and do not need to separate microorganisms. Pur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/04C12Q1/68
CPCY02A50/30
Inventor 曹以诚李志勇杜正平陈洵谭惠媚易敏英
Owner GUANGZHOU HUAFENG BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More