Rapid diagnosis reagent kit and detection method for vibrio vulnficus gene
A technology for rapid diagnosis of Vibrio vulnificus, applied in biochemical equipment and methods, measurement/inspection of microorganisms, resistance to vector-borne diseases, etc., to achieve high verification rate, simple identification, and high yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0035] Preparation of Example 1 Kit
[0036] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0037] Outer primer F3: TGAGAACGGTGACAAAACGG;
[0038] Outer primer B3: GAGCTTATCGCCTTCCCAAT;
[0039] Inner primer FIP: AGGCCCCAAACTTGGTTCCAATTTTTTGCGGGTGGTTCGGTTA;
[0040] Inner primer BIP:
[0041] AGCCGAGTRGCATCCGATCGTTTTGCTAAGTTCGCACCACACT;
[0042] (2) Purchase DNA polymerase: BstDNA polymerase (large fragment), and place it in a container.
[0043](3) prepare reaction solution: the formula of reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, internal The primers FIP / BIP were each prepared by 2 mol and the outer primers F3 / B3 were each 0.25 mol, and placed in a container.
[0044] (4) Preparation of sample pretreatment solution: The formula of sample pretreatment solution is prepared by containing 2...
Embodiment 2
[0055] Example 2 Preparation of the kit
[0056] The formula of the reaction solution is: each 1L reaction solution contains 1.6 mmol dNTP, 20 mmol Tris-HCl, 10 mmol potassium chloride, 10 mmol ammonium sulfate, 8 mmol magnesium sulfate, 1 ml TritonX-100, 0.8 mol betaine, and 1.6 1.6 each of inner primer FIP / BIP. mol and outer primer F3 / B3 each 0.2mol;
[0057] The formula of the sample pretreatment solution is as follows: each 1L of the sample pretreatment solution contains 10 mmol pH8.0 Tris-HCl, 1 mmol EDTA and 10 ml Triton X-100.
[0058] The developer solution is EvaGreen.
[0059] Others are the same as in Example 1.
Embodiment 3
[0060] Example 3 Application of Vibrio vulnificus gene rapid diagnostic kit
[0061] 1. Sample processing (template DNA extraction)
[0062] (1) Take about 200ml of water sample (or sediment, ooze, etc.) using aseptic operation technology. If there is any impurity, it can be left to settle or centrifuged at 1000r / min for 1min to remove large particles;
[0063] (2) Filter the precipitated or centrifuged sample (supernatant) through a filter membrane with a pore size of 0.22 μm to 0.45 μm, remove the filter membrane and place it in 15 ml of sterile water to fully elute;
[0064] (3) Take 5ml of elution sample, centrifuge at 10000rpm for 2min to obtain bacterial cell precipitation;
[0065] (4) Add 100 μl of sample pretreatment solution to the above bacterial cell precipitation, mix well, boil in boiling water for 10 minutes, then place on ice for 10 minutes, centrifuge at 10,000 rpm for 2 minutes, and the supernatant is the sample template DNA.
[0066] 2. The reaction proces...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap