Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof

A gene detection and kit technology, which is applied in the field of primer sets for NPTII gene detection, can solve the problems of rapid detection kits for NPTII genes of genetically modified crops that have not been found, and achieves high amplification efficiency, maintains complete sealing, and reduces pollution. Effect

Active Publication Date: 2012-07-11
GUANGZHOU HUAFENG BIOTECH
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in the detection technology of genetically modified products, the established loop-mediated isothermal amplification technology (loop-mediated isothermal amplification of DNA, referred to as LAMP), has many advantage, and there is no useful loop-mediated isothermal amplification technology to detect transgenic crop NPTII gene rapid detection kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof
  • Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof
  • Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Embodiment 1 detects the preparation of the kit of NPTII gene

[0071] (1) Synthesize oligodeoxynucleotide primers by DNA synthesizer according to the following sequence:

[0072] Outer primer F3(1): (SEQ ID NO 1)

[0073] GCTGGATCGTTTCGCATGA

[0074] Outer primer B3(1): (SEQ ID NO 2)

[0075] GCAGTTCATTCAGGGCACC

[0076] Internal primer FIP(1): (SEQ ID NO 3)

[0077] GCCCAGTCATAGCCGAATAGCCTTTTGAACAAGATGGATTGCACGC

[0078] Internal primer BIP(1): (SEQ ID NO 4)

[0079] GACAATCGGCTGCTCTGATGCCTTTTGGACAGGTCGGTCTTGACA

[0080] (2) Purchase DNA polymerase: BstDNApolymerase (large fragment) and place it in a container;

[0081] (3) Preparation of reaction solution: The formula of the reaction solution contains 2mmoldNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, and internal primer FIP per 1L solution 2 mol each of BIP and 0.25 mol each of the outer primers F3 / B3 were prepared an...

Embodiment 2

[0092] Embodiment 2 detects the preparation of the kit of NPTII gene

[0093] The reaction solution contains 1.6mmoldNTP, 20mmol Tris-Cl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, 1.6mol each of internal primer FIP / BIP and external primer F3 per 1L / B3 each 0.2mol preparation, put in the container.

[0094] The chromogenic solution is Eva Green.

[0095] Others are the same as embodiment 1.

Embodiment 3

[0096] Embodiment 3 detects the preparation of the kit of NPTII gene

[0097] Other conditions are identical with embodiment 1, and its difference is only that the primer in step (1) is:

[0098] Outer primer F3(2): (SEQ ID NO 5)

[0099] CTGTTCGCCAGGCTCAAG

[0100] Outer primer B3(2): (SEQ ID NO 6)

[0101] CGCCAAGCTCTTCAGCAATA

[0102] Internal primer FIP(2): (SEQ ID NO 7)

[0103] GAAAAGCGGCCATTTTCCACCATTTTGCGAGGATCTCGTCGTGA

[0104] Internal primer BIP(2): (SEQ ID NO 8)

[0105] GGATTCATCGACTGTGGCCGGTTTTGGTAGCCAACGCTATGTCC.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group for NPT(Noctumal Penile Tumescence)II gene detection, which consists of an outer primer F3, an outer primer B3, an FIP (Forward Inner Primer) and a BIP (Backward Inner Primer); nucleotide sequences of the outer primer F3, the outer primer B3, the FIP and the BIP are respectively shown by SEQ (Sequence) ID (Identity) No. 1-4 or SEQ ID No. 5-9. The primer group has the beneficial effects that whether a target substance exists or not can be judged according to whether to amplify or not, and the specificity is high. The invention also discloses a reagent kitfor detecting a NPTII gene, which comprises two pairs of primers, i.e. an FIP / BIP and an outer primer F3 / B3, which takes the NPTII gene as a target gene and is designed based on a loop-mediated isothermal amplification technology. The reagent kit has the beneficial effects that the NPTII gene can be quickly detected, the amplification can be carried out only by one constant temperature, a specialreagent or equipment is not required, the detection cost is low, and moreover, the sensitivity and the specificity are high. Meanwhile, the invention also discloses a use method of the reagent kit.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a primer set for NPTII gene detection, a corresponding kit and a use method thereof. Background technique [0002] As a neomycin phosphotransferase gene, NPTII gene is widely used in transgenic crops such as transgenic corn and rapeseed. [0003] In order to strengthen the supervision and management of genetically modified products, a variety of genetically modified component detection methods have been developed, from protein-based ELISA detection technology to nucleic acid-based polymerase chain reaction (PCR) technology and the rapidly developing gene chip technology. Among them, PCR detection technology is the most common because of its sensitivity, specificity, and high efficiency. This technology is identified by detecting exogenous nucleic acid fragments contained in gene products. ) can not only carry out the qualitative identification of genetically modified products, b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 曹以诚杜正平陈洵谭慧媚熊槐茅丽娜
Owner GUANGZHOU HUAFENG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com