Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof
A gene detection and kit technology, which is applied in the field of primer sets for NPTII gene detection, can solve the problems of rapid detection kits for NPTII genes of genetically modified crops that have not been found, and achieves high amplification efficiency, maintains complete sealing, and reduces pollution. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] Embodiment 1 detects the preparation of the kit of NPTII gene
[0071] (1) Synthesize oligodeoxynucleotide primers by DNA synthesizer according to the following sequence:
[0072] Outer primer F3(1): (SEQ ID NO 1)
[0073] GCTGGATCGTTTCGCATGA
[0074] Outer primer B3(1): (SEQ ID NO 2)
[0075] GCAGTTCATTCAGGGCACC
[0076] Internal primer FIP(1): (SEQ ID NO 3)
[0077] GCCCAGTCATAGCCGAATAGCCTTTTGAACAAGATGGATTGCACGC
[0078] Internal primer BIP(1): (SEQ ID NO 4)
[0079] GACAATCGGCTGCTCTGATGCCTTTTGGACAGGTCGGTCTTGACA
[0080] (2) Purchase DNA polymerase: BstDNApolymerase (large fragment) and place it in a container;
[0081] (3) Preparation of reaction solution: The formula of the reaction solution contains 2mmoldNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, and internal primer FIP per 1L solution 2 mol each of BIP and 0.25 mol each of the outer primers F3 / B3 were prepared an...
Embodiment 2
[0092] Embodiment 2 detects the preparation of the kit of NPTII gene
[0093] The reaction solution contains 1.6mmoldNTP, 20mmol Tris-Cl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, 1.6mol each of internal primer FIP / BIP and external primer F3 per 1L / B3 each 0.2mol preparation, put in the container.
[0094] The chromogenic solution is Eva Green.
[0095] Others are the same as embodiment 1.
Embodiment 3
[0096] Embodiment 3 detects the preparation of the kit of NPTII gene
[0097] Other conditions are identical with embodiment 1, and its difference is only that the primer in step (1) is:
[0098] Outer primer F3(2): (SEQ ID NO 5)
[0099] CTGTTCGCCAGGCTCAAG
[0100] Outer primer B3(2): (SEQ ID NO 6)
[0101] CGCCAAGCTCTTCAGCAATA
[0102] Internal primer FIP(2): (SEQ ID NO 7)
[0103] GAAAAGCGGCCATTTTCCACCATTTTGCGAGGATCTCGTCGTGA
[0104] Internal primer BIP(2): (SEQ ID NO 8)
[0105] GGATTCATCGACTGTGGCCGGTTTTGGTAGCCAACGCTATGTCC.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 