43results about How to "Avoid spreading the epidemic" patented technology

The invention discloses primer pairs, a detection method and a fast diagnostic kit for detecting red-spotted grouper nervous necrosis viruses. The primer pairs comprise the following four primers: an inner primer FIP, an inner primer BIP, an external primer F3 and an external primer B3. Both the primer pairs and the kit of the invention can detect the red-spotted grouper nervous necrosis viruses with high efficiency and high specificity, as well as are based on loop-mediated isothermal amplification technology, apply six segments, four primers and one constant temperature, complete an amplification reaction within 1 hour, and are low in detection cost, short in detection time, high in yield and specificity, obvious in negative and positive result color developing difference, high in verification rate, obvious and reliable in verification. The kit is provided with a set of optimized reverse transcription-loop-mediated isothermal amplification reaction system can be used for detecting red-spotted grouper nervous necrosis viruses at different stages in a fish culture process, avoids viral spread and prevalence, improves scientific management efficiency and has high practical value.

The present invention is prawn white spot syndrome virus gene diagnosing kit and its usage. The kit and its usage is designed based on two pairs of primers for the conservation sequence of prawn white spot syndrome virus gene. By means of PCR technology, the present invention detects qualitatively the specific DNA nucleic acid segment of prawn white spot syndrome virus fast, simply, specifically and sensitively. The present invention may be used in the tracing detection of different stages of prawn cultivation and environment monitoring.

The invention discloses a biological prevention and control method for controlling prawn diseases through Tilapia. The method of the invention realizes the prevention for infectious diseases of the prawn and the increase of prawn survival rate by introducing Tilapia to prawn cultivation zones. The method of the invention can prevent prawn diseases from propagating and becoming epidemic in healthy prawn community, reduce the workload of manually removing diseased and dead prawns, enhance the removal efficiency and the cultivation success rate and bring tremendous economical benefit to the culturist.

The present invention is mandarin fish infectious spleen and kidney necrosis virus gene diagnosing kit and its usage. The kit and its usage is designed based on two pairs of primers for the conservation sequence of mandarin fish infectious spleen and kidney necrosis virus gene. By means of PCR technology, the present invention detects qualitatively the specific DNA nucleic acid segment of mandarin fish infectious spleen and kidney necrosis virus fast, simply, specifically and sensitively. The present invention may be used in the tracing detection of different stages of mandarin fish cultivation and environment monitoring.

The invention discloses a biological prevention and control method for controlling shrimp diseases through carps. In the method, carps are put into a shrimp culture zone, so that shrimp infectious diseases can be prevented and the survival rate of shrimps is increased. Through the method, shrimp diseases can be prevented from spreading among healthy shrimps, the workload of manual removing of sick and dead shrimps is lowered, removing efficiency is improved, culturing success rate is increased and greater economic benefit is brought for culturists.

A kit used for diagnosing reovirus of juyuanqin crab consists of a pair of primer designed according to RNA sequence of a reovirus separated out from ill juyuanqin crab. Its detection method utilizes reverse transcription - polymerase chain reaction technique to carry out qualitative detection on specific RNA nucleic acid section of reovirus on juyuanqin crab.

The invention discloses a detection primer group, a detection kit, and a detection method of nocardia seriolae, vibrio harveyi, and streptococcus iniae. The detection primer group comprises a primer pair Ns-mce, a primer pair Vh-tox, and a primer pair Si-its; the nucleotide sequences of the primer pairs are represented by SEQ ID NO.1-6. The detection kit comprises above detection primer group. According to the detection method, the detection kit is used for detection; samples are subjected to pretreatment, genome DNA is extracted as sample group DNA, and PCR is adopted to detect the samples. A triplex PCR detection method is established for tracking measurement of nocardia seriolae, vibrio harveyi, and streptococcus iniae at different periods, avoiding transmission of pathogenic bacteria, and improving rapid inspection and quarantine of pathogenic bacteria in aquatic products; and the invention belongs to the field of aquatic cultured animal pathogenic bacteria detection.

The invention discloses a method for preventing and controlling shrimp communicable diseases through twice epinephelus coioids release. In the method, epinephelus coioids of two different size specifications are released in a prawn culture region twice, thus the prevention and control of the peneldshrimp communicable diseases can be realized, and the survival rate of prawns can be improved. By utilizing the method disclosed by the invention, shrimp diseases can be prevented from being spread and popularized among healthy shrimp clusters, the work load of artificially removing sick shrimps and died shrimps is reduced, the removing efficiency and the culture success ratio are improved, and greater economic benefits are brought to culturists.

The invention provides a gene diagnosis reagent box and its detecting method for aquatic animal (like cyprinoid, Penaeus monodon, Epinephelus awoara, ormer, etc) and human pathogens-Vibrio fluvialis, designed by using a pair of primers designed by the sequence in conservative region of Vibrio fluvialis gene to act as main body. It adopts polyase chain reaction (PCR) technique to qualitatively detect the specific DNA fragments of the Vibrio fluvialis, simply and conveniently, and rapidly, good-specificity, and high-sensitivity; can be used in bacteria tracking detection of aquatic animal pathogens in the course of breeding in each period, and also the clinic detection of human intestinal acute infections, as well as environmental monitoring, avoiding the pathogens infecting and popularizing and it has very great practical value.

The invention relates to a kit for diagnosing the reovirus genes of grass carps, comprising an RNA (Ribonucleic Acid) extraction reagent for viruses in visceral tissues, an RAN extraction reagent for cell infecting viruses, an RT (Reverse Transcriptase) reaction reagent and a PCR (Polymerase Chain Reaction) reaction reagent, wherein the RNA extraction reagent for the viruses in the visceral tissues comprises the components of DEPC (Diethyl Pyrocarbonate) water, protease K (1 mg / mL, pH is 8.0), SDS (Sodium Dodecyl Sulfate) (1%), phenol / chloroform / isoamylol (25 / 24 / 1), chloroform / isoamylol (24 / 1), isopropanol and 70% ethanol; the RAN extraction reagent for the cell infecting viruses comprises the components of Trizol, chloroform, isopropanol, 70% ethanol and the DEPC water; the RT reaction reagent comprises the components of 5*AMV Buffer, dNTP, the DEPC water, a reverse primer R1, an RNA enzyme inhibitor RNAsin (R1) and a reverse transcriptase AMV; and the PCR reaction reagent comprises the components of 10*PCR buffer (containing Mg<2+>) and DNTP Mixture (which are respectively 2.5 mmol / L), a specific oligonucleotide primer F1, the primer R1, the DEPC water and Taq E (5U / muL), the forward primer F1:5'-ATCCCGTATATCTATGGCTT-3', and the reverse primer R1:5'TTGGAGACGAACATAGACGC-3. The kit is used for diagnosing the reovirus genes of the grass carps.

The invention provides a primer group for detecting vibrio coralliilyticus by using LAMP, a quick diagnosis kit and a detecting method. The primer group comprises an external primer pair and an internal primer pair, wherein the external primer pair is VCF3(TGGTTGCAGGTGACATCAC) and VCB3(TCTACTGGGCTGTACGTAGC); the internal primer pair is VCFIP(CATWGCGATCTCAGCGTTGTCTTTTGATCGCTAACCCAGAACACG) and VCBIP(TGGTTACGTTCCAGCTTCAGCTTTCAACCAGTAGGCGACCRAT); W equals to A and T; and R equals to A and G. The invention also discloses a quick diagnosis kit containing the primer group and a detecting method. The primer group, the quick diagnosis kit and the detecting method have the advantages of short detection time, strong specificity and high detection sensitivity.

The invention discloses a self-propulsion type wind and wave resistant deepwater net cage. The self-propulsion type wind and wave resistant deepwater net cage comprises a frame, a net and a fixing mooring component used for fixing the net cage in water. The net is fixed to the frame, the net is stretched with the open of the frame, the fixing mooring component and the frame are connected, in addition, the self-propulsion type wind and wave resistant deepwater net cage further comprises a hydraulic propelling device, the hydraulic propelling device is composed of a propeller thruster, a hydraulic motor, a hydraulic circuit, a hydraulic pump and a driving motor, wherein the driving motor and the hydraulic pump are connected and drive the hydraulic pump to work, the hydraulic pump is connected with the hydraulic motor through the hydraulic circuit and drives the hydraulic motor to revolve, and the hydraulic motor and the propeller thruster are connected and reversedly drive the propeller thruster to rotate. The net cage has the advantages that the structure is simple, conducting offshore pilling operation in advance is not needed, the net cage can navigate and move in the water of itself, dragging by a tugboat is not needed, and an excellent wind and wave resistant ability is possessed.

The invention provides a gene diagnosis kit and detection method for major cattle pathogenic bacteria-Pasteurella multocida and belongs to the technical field of bioscience. The kit and the detection method are designed by taking a pair of primers as the main body, and the primers are designed according to the Pasteurella multocida gene conservative area sequence. According to the invention, the polymerase chain reaction (PCR) technology is adopted for qualitatively detecting the specificity DNA fragments of cattle pathogenic bacteria-Pasteurella multocida simply, conveniently and quickly, the specificity is good and the sensitivity is high; the kit and the detection method can be used for clinical detection of cattle pasteurellosis, bacteria tracking and detecting in all cattle farming periods and monitoring of the cattle farming environment and avoid pathogen transmission and outbreak, thereby achieving a very high utility value.

The invention discloses a quick diagnostic kit for abalone shriveling syndrome associated virus (AbSV). The quick diagnostic kit comprises the following components: (1) DNA extract; (2) digestive juice; (3) G1 liquid used for polymerase chain reaction (PCR) amplification reaction and comprising Buffer containing Mg<2+>, dNTP, forward primer F1, reverse primer R1 and Taq enzyme, wherein F1 is 5-ATGACAGATTTCACCGTAAGCAATGAAAATC-3, and R1 is 5-CTAGCTGGCTTTGGTATAAGTAGTACCAAAAG-3; and (4) positive control H liquid, which is 100ng / muL of AbSV infected abalone genome DNA. The invention also disclosesa method for detecting the AbSV by using the quick diagnostic kit. The quick diagnostic kit and the detection method provided by the invention can be used for virus tracking detection of each period in the abalone culture process, can also be used for environment monitoring, avoid viral transmission, improve the scientific management efficiency, and have a very high practical value.

The present invention is mandarin fish infectious spleen and kidney necrosis virus gene diagnosing kit and its usage. The kit and its usage is designed based on two pairs of primers for the conservation sequence of mandarin fish infectious spleen and kidney necrosis virus gene. By means of PCR technology, the present invention detects qualitatively the specific DNA nucleic acid segment of mandarin fish infectious spleen and kidney necrosis virus fast, simply, specifically and sensitively. The present invention may be used in the tracing detection of different stages of mandarin fish cultivation and environment monitoring.

The invention provides a kind of gene consultation kit and testing process to prawn TSV( Taura Syndrome virus). The kit and the testing process are designed based on list in conservation area of TSV. The invention adopts RT-PCR technology to test special RNA nucleic acids of TSV. This method is quick and its specificity is good and sensitivity is high. It can be used to test virus in different period when cultivate prawn. It also can be used to test environment to avoid dissmination of virus. Thus, it can improve efficiency of scientific management and has high utility value.

The invention provides a gene diagnosing reagent box and the detecting method of sea marine lives (such as shrimp, fish and so on) and human pathogenic bacterium-vibrio alginolyticus. There agent box and the detecting method are designed using a pair of primer as main body of vibrio alginolyticus gene protected area series design. The invention uses poly enzyme chain reaction (PCR) technology to carry on qualitative detection to the special DNA piece of the sea marine product and human pathogenic bacterium-vibrio, the method is quick, and the singularity is excellent, the sensitivity is high; it can be applied to the bacterium tracing and detecting to the sea marine product in each period, it also can be applied to the clinic detection of human intestinal canal acute contagion, and the environment detection and so on.

The invention discloses prawn culture apparatus. The apparatus comprises a culture box and a net box, wherein the inner walls of two ends of the culture box are provided with installation grooves, theinner walls of two sides of each installation groove are rotationally connected with the same screw rod, the outer wall of the circumference of each screw rod is rotationally connected with a slidingblock through threads, fixing blocks are installed on the outer walls of two ends of the net box, and the bottom outer wall of each fixing block is provided with a sliding groove matching the corresponding sliding block. In the prawn culture apparatus, arc-shaped sounding copper plates are arranged, and tilapia can move inside the net box, so that a driven water flow or the tilapia itself can hitconnecting plates, mounting plates and the like, one sides, close to the arc-shaped sounding copper plates, of the mounting plates can be swung up and down, thereby iron balls on rubber rods are driven to hit the arc-shaped sounding copper plates to make a sound to drive away prawns close to the net box, diseased shrimps are slow in response and can enter the net box through tapered holes in thenet box, and are caught and eaten by the tilapia, the spread of shrimp diseases in healthy shrimp populations can be prevented, and the workload of manual cleaning of the diseased shrimps is reduced.

The invention discloses a biological prevention and control method for controlling prawn diseases with clarias lazera. According to the method provided by the invention, clarias lazeras are added into a prawn culture zone, such that prawn infectious disease prevention is realized, and prawn survival rate is improved. With the method, prawn diseases can be prevented from spreading in healthy prawn populations; work load of artificially removing diseased and dead prawns is reduced; removing efficiency and culture success rate are improved; and higher economic benefit is brought to farmers.

The invention provides a biological control method of controlling prawn diseases through grass carps. The method is characterized by putting grass carps in a prawn culture area to prevent the infectious diseases of prawns and increase the survival rate of prawns. The method can prevent the spreading and prevalence of prawn diseases in healthy prawn groups, reduce workload for removing diseased prawns and dead prawns manually, increase the removal efficiency and culture success rate, and bring greater economic benefit for culturists.

The invention discloses a triplex seven-fold PCR detection primer set for virulence genes of Streptococcus agalactiae, including virulence genes sip, fbsA, hylB, cfb, sodA, DltR, cspA, ponA, bibA, srr-1, bca, PCR amplification primer pairs corresponding to iagA, scpB, fbsB, pavA, psaA, spb1, bac, cppA, lmb and cylE. The sequences of each primer are shown in the sequence table. The invention also discloses a reagent kit comprising the above primer set and a three-in-one seven-fold PCR detection method of the Streptococcus agalactiae virulence gene using the above primer set. The detection method uses sip, fbsA, hylB, cfb, sodA, DltR and cspA as the first group, ponA, bibA, srr-1, bca, iagA, scpB and fbsB as the second group, pavA, psaA, spb1, bac , cppA, lmb and cylE are the third group, and PCR reaction is carried out under the same reaction conditions at the same time, and the target sequences of 21 virulence gene target fragments are amplified at the same time. Source and typing of Streptococcus lactis host, and evaluate the variation of strain virulence gene profile.

The invention discloses a biological prevention and control method for controlling prawn diseases with carps. According to the method provided by the invention, carps are added into a prawn culture zone, such that prawn infectious disease prevention is realized, and prawn survival rate is improved. With the method, prawn diseases can be prevented from spreading in healthy prawn populations; work load of artificially removing diseased and dead prawns is reduced; removing efficiency and culture success rate are improved; and higher economic benefit is brought to farmers.

The invention provides a gene diagnosing reagent box and the detecting method of sea marine lives (such as shrimp, fish and so on) and human pathogenic bacterium-vibrio alginolyticus. There agent box and the detecting method are designed using a pair of primer as main body of vibrio alginolyticus gene protected area series design. It uses poly enzyme chain reaction (PCR) technology to carry on qualitative detection to the special DNA piece of the sea marine product and human pathogenic bacterium-vibrio, the method is quick, and the singularity is excellent, the sensitivity is high; it can be applied to the bacterium tracing and detecting to the sea marine product in each period, it also can be applied to the clinic detection of human intestinal canal acute contagion, and the environment detection and so on.

The invention discloses a quick diagnostic kit for abalone shriveling syndrome associated virus (AbSV). The quick diagnostic kit comprises the following components: (1) DNA extract; (2) digestive juice; (3) G1 liquid used for polymerase chain reaction (PCR) amplification reaction and comprising Buffer containing Mg<2+>, dNTP, forward primer F1, reverse primer R1 and Taq enzyme, wherein F1 is 5-ATGACAGATTTCACCGTAAGCAATGAAAATC-3, and R1 is 5-CTAGCTGGCTTTGGTATAAGTAGTACCAAAAG-3; and (4) positive control H liquid, which is 100ng / muL of AbSV infected abalone genome DNA. The invention also disclosesa method for detecting the AbSV by using the quick diagnostic kit. The quick diagnostic kit and the detection method provided by the invention can be used for virus tracking detection of each period in the abalone culture process, can also be used for environment monitoring, avoid viral transmission, improve the scientific management efficiency, and have a very high practical value.

The invention discloses a detection primer set for Streptococcus agalactiae, comprising a primer pair hylB, a primer pair ponA and a primer pair cfb; wherein, the primer pair hylB includes a primer whose nucleotide sequence is shown in SEQ ID NO.1 hylB-F and nucleotide sequence such as primer hylB-R shown in SEQ ID NO.2; said primer pair ponA includes nucleotide sequence such as primer ponA-F and nucleotide sequence shown in SEQ ID NO.3 Primer ponA-R as shown in SEQ ID NO.4; Described primer pair cfb comprises nucleotide sequence as shown in the primer cfb-F of SEQ ID NO.5 and nucleotide sequence as shown in SEQ ID NO.6 Primer cfb‑R. The invention also discloses a detection kit comprising the primer set and a multiplex PCR detection method using the detection kit. The invention has good specificity, high sensitivity, simplicity, speed, efficiency and precision, and is suitable for dairy-free products in pollution-free aquatic products. The rapid inspection and quarantine of streptococcus can be directly applied to the early monitoring and early warning of aquaculture diseases. The minimum concentration for detection of Streptococcus agalactiae DNA is 7.74×10 ‑3 ng / uL, no need for bacterial culture, less sample required for detection, and minimally invasive sampling can be achieved.

The present invention is rockfish viral nervous virus gene diagnosing kit and its usage. The kit and its usage is designed based on two pairs of primers for the conservation sequence of rockfish viral nervous virus gene. By means of PCR technology, the present invention detects qualitatively the specific DNA nucleic acid segment of tiger frog virus fast, simply, specifically and sensitively. The present invention may be used in the tracing detection of different stages of rockfish cultivation and environment monitoring.

The invention discloses a primer group for detecting the reovirus and bicistronic virus of scylla serrata, comprising a reovirus forward primer ReoF, a reovirus reverse primer ReoR, a bicistronic virus forward primer DicF and a bicistronic virus reverse primer DicR, wherein each primer is specifically as follows: ReoF: 5-ACTCATAGAGCAGTCATGGG-3; ReoR: 5-ATATCGTCAGAATGTCGTTC-3; DicF: 5-GGATACTATGGATGATGTTTC-3; and DicR: 5-ACAAAATACCAGATAAAGCAA-3. The invention further discloses a kit containing the primer group and a detection method. The primer group, the kit and the detection method are shortin detection time, strong in specificity, high in detection sensitivity, and capable of simultaneously detecting the reovirus and bicistronic virus of scylla serrata.

The invention discloses primer pairs, a detection method and a fast diagnostic kit for detecting red-spotted grouper nervous necrosis viruses. The primer pairs comprise the following four primers: an inner primer FIP, an inner primer BIP, an external primer F3 and an external primer B3. Both the primer pairs and the kit of the invention can detect the red-spotted grouper nervous necrosis viruses with high efficiency and high specificity, as well as are based on loop-mediated isothermal amplification technology, apply six segments, four primers and one constant temperature, complete an amplification reaction within 1 hour, and are low in detection cost, short in detection time, high in yield and specificity, obvious in negative and positive result color developing difference, high in verification rate, obvious and reliable in verification. The kit is provided with a set of optimized reverse transcription-loop-mediated isothermal amplification reaction system can be used for detecting red-spotted grouper nervous necrosis viruses at different stages in a fish culture process, avoids viral spread and prevalence, improves scientific management efficiency and has high practical value.

The invention discloses a primer set for testing mud crab bicistronic mRNA virus, a test method and a rapid diagnosis kit. The primer set includes the following four primers: outer primer F3, outer primer B3, inner primer FIP and inner primer BIP. The primer set for testing mud crab bicistronic mRNA virus, the test method and the rapid diagnosis kit can test mud crab bicistronic mRNA virus at high efficiency and high specificity, the specificity of the primer set is high, and the test method has the advantages of low test cost, short time consumption, high productivity, high specificity, remarkable color difference between negative and positive results and high verification rate, and is clearer and more reliable; and the kit in the invention establishes a set of optimized inverse transcription-loop-mediated isothermal amplification reaction system, can be used for tracking and testing mud crab dbicistronic mRNA virus at each stage in the process of culturing blue crabs, and can prevent the spread of virus, so the efficiency of scientific management is increased, and the high practical value is realized.