Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof
A kit and gene technology, applied in the field of primer sets for NPTII gene detection, can solve problems such as the rapid detection kit for NPTII gene detection in transgenic crops, etc., and achieve the effects of strong amplification efficiency, reducing pollution and maintaining complete sealing.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] Embodiment 1 detects the preparation of the kit of NPTII gene
[0071] (1) Synthesize oligodeoxynucleotide primers by DNA synthesizer according to the following sequence:
[0072] Outer primer F3(1): (SEQ ID NO 1)
[0073] GCTGGATCGTTTCGCATGA
[0074] Outer primer B3(1): (SEQ ID NO 2)
[0075] GCAGTTCATTCAGGGCACC
[0076] Internal primer FIP(1): (SEQ ID NO 3)
[0077] GCCCAGTCATAGCCGAATAGCCTTTTGAACAAGATGGATTGCACGC
[0078] Internal primer BIP(1): (SEQ ID NO 4)
[0079] GACAATCGGCTGCTCTGATGCCTTTTGGACAGGTCGGTCTTGACA
[0080] (2) Purchase DNA polymerase: BstDNApolymerase (large fragment) and place it in a container;
[0081] (3) Preparation of reaction solution: The formula of the reaction solution contains 2mmol of NTP, 25mmol Tris-Cl, 12.5mmol of potassium chloride, 12.5mmol of ammonium sulfate, 10mmol of magnesium sulfate, 1.25ml of TritonX-100, 1mol of betaine, and the internal primer FIP per 1L of the solution. 2 mol each of BIP and 0.25 mol each of the outer ...
Embodiment 2
[0092] Embodiment 2 detects the preparation of the kit of NPTII gene
[0093] The reaction solution contains 1.6mmoldNTP, 20mmol Tris-Cl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, 1.6mol each of internal primer FIP / BIP and external primer F3 per 1L / B3 each 0.2mol preparation, put in the container.
[0094] The chromogenic solution is Eva Green.
[0095] Others are the same as embodiment 1.
Embodiment 3
[0096] Embodiment 3 detects the preparation of the kit of NPTII gene
[0097] Other conditions are identical with embodiment 1, and its difference is only that the primer in step (1) is:
[0098] Outer primer F3(2): (SEQ ID NO 5)
[0099] CTGTTCGCCAGGCTCAAG
[0100] Outer primer B3(2): (SEQ ID NO 6)
[0101] CGCCAAGCTCTTCAGCAATA
[0102] Internal primer FIP(2): (SEQ ID NO 7)
[0103] GAAAAGCGGCCATTTTCCACCATTTTGCGAGGATCTCGTCGTGA
[0104] Internal primer BIP(2): (SEQ ID NO 8)
[0105] GGATTCATCGACTGTGGCCGGTTTTGGTAGCCAACGCTATGTCC.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


