Hog cholera antibody ELISA diagnosis reagent kit

A technology of swine fever virus and antigen, which is applied in the field of animal biological products manufacturing, and can solve the problems of instability, instability and high cost of enzyme-linked reactions

Active Publication Date: 2013-04-03
CHINA INST OF VETERINARY DRUG CONTROL
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main reasons are as follows: ① Prokaryotic antigen expression: the expressed antigen is inclusion body, poor sensitivity, and unstable enzyme-linked reaction; ② Antigen purification from whole virus: Two methods have been used, one is ammonium sulfate precipitation method, and the other is ammonium sulfate precipitation method. One is ultrafiltration and concentration followed by ultracentrifugation, but the cost is too high, the technology is difficult, the yield is extremely low, and the swine fever virus is easy to crack, etc.
The methods established in our country also include ELISA method, hemagglutination inhibition test, etc., but all of them are unstable.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hog cholera antibody ELISA diagnosis reagent kit
  • Hog cholera antibody ELISA diagnosis reagent kit
  • Hog cholera antibody ELISA diagnosis reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] [specific implementation plan]

[0012] 1. Construction route:

[0013] Construct the technical route of the pMEL-SE2M-HIS carrier of the recombinant AcMNPV VFBMEL-SE2M-HIS containing the classical swine fever virus gene E2 gene (see attached figure 1 ).

[0014] 2. Carrier construction

[0015] 1. Construction of signal peptide and 6×HIS purification tag vector (pMEL-HIS)

[0016] 4 primers were designed, the signal peptide sequence, adapter sequence and 6×HIS sequence were amplified by gene splicing (Gene splicing by over lap extension) technology for PCR amplification, double digestion (BamHI / KpnI) pFastBacl vector and PCR product, ligation, Transformation screening, sequencing identification. The reconstituted vector was named pMEL-HIS.

[0017] (1) The primer sequence is:

[0018] MFP: GATCGGATCCATGAAATTCTTAGTCAACGT TGCCCTTGTTTTTTATGGTCGTAT

[0019] MRP: GAAATG TATACGACCATAAAAACAAGGGCA

[0020] HFP: TCAGATTCC ACGAAGTCGACGGCGCCATGGGAC

[0021] HRP...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an ELISA diagnosis kit for swine fever virus. In the invention, by gene splicing technology, the swine fever virus E2 is jointed with secretion signal peptide sequence and purification label at two sides and is inserted into the autographa californica nucleopolyhedrosis virus expression vector so as to construct recombinant autographa californica nucleopolyhedrosis virus CGMCC No.2671 and to obtain coated ELISA swine fever virus Shimen Strain E2 gene soluble expression antigen. The kit of the invention is rapid, sensitive, and specific to the diagnosis and the immune evaluation of swine fever virus, and the diagnosis can be completed once within 2 hours.

Description

【Technical field】 [0001] The invention relates to a swine fever antibody ELISA diagnostic kit, which belongs to the field of animal biological products manufacturing. 【technical background】 [0002] Classical swine fever, also known as classical swine fever (Classical Swine Fever, CSF), is a highly lethal, contagious disease of pigs caused by classical swine fever virus (CSFV). It is one of the major infectious diseases that the World Food and Agriculture Organization and governments of various countries pay close attention to. According to the 2005 edition of the "Terrestrial Animal Health Code" formulated by OIE, CSF is listed as one of the legally notifiable diseases, and it is listed as "a first-class animal disease" in my country, which has brought huge economic losses to my country's pig industry. [0003] All countries in the world have listed swine fever epidemic prevention as the focus of national animal health administrative work, and adopted prevention, epidemic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/569G01N33/543G01N33/531
Inventor 范学政王琴徐璐赵启祖
Owner CHINA INST OF VETERINARY DRUG CONTROL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products