A taqman Real-time RT-PCR kit for detection of Peste des petits ruminants virus

A technology of Peste des petits ruminants and kits, which is applied in the direction of microorganism-based methods, microorganism measurement/inspection, microorganisms, etc., can solve the problems of not being able to meet the needs of rapid, sensitive, accurate and quantitative detection, and achieve high accuracy, Strong sensitivity, anti-pollution effect

Active Publication Date: 2016-03-16
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The technical problem to be solved by the present invention is to overcome the inability of the prior art to meet the rapid, sensitive, accurate and quantitative detection requirements, thereby providing a rapid, sensitive, accurate and quantitative detection of virus for the detection of Peste des petits ruminants virus TaqmanReal-timeRT-PCR reagent kit, the present invention also provides the use method of this reagent kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A taqman Real-time RT-PCR kit for detection of Peste des petits ruminants virus
  • A taqman Real-time RT-PCR kit for detection of Peste des petits ruminants virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1. Design and preparation of primers:

[0036] Refer to GenBank (gene bank) to find ten strains, find the conserved regions on each sequence through sequence comparison, select the conserved regions and design a pair of amplification primers and a probe primer, the sequence is as follows:

[0037] The amplification primer sequences are:

[0038] SEQ ID NO.1: Upstream primer TTAATTGATTGGGCTGATGGTCT,

[0039] SEQ ID NO.2: downstream primer GCTGCCGGCAATGATGTCTC.

[0040] The probe primer sequence is:

[0041] SEQ ID NO. 3: GTTCTTGACATCGGGTATTTCCGGGAC.

[0042] The above primers were synthesized and labeled by Dalian Bao Biological Engineering Co., Ltd.

[0043] Positive control: the positive control of the kit of the present invention and its standard curve were constructed and preserved by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.

[0044] 2. Prepare the kit:

[0045] This kit consists of the following components:

...

Embodiment 2

[0059] Step 1~2 is with embodiment 1;

[0060] 3. The method for detecting PPRV with the kit of the present invention:

[0061] (1) The total PCR system is 25 μl. In the kit of the present invention, a.2×OneStepRT-PCRbufferIII: 12.5 μL; b.ExTaqHS: 0.5 μL; c. PrimerScriptRTEnzymeMixII: 0.5 μL; d. a total of 3 μl of three primers; f. 5.5 μl of RNase-free water were added to 0.2ml amplification tube;

[0062] (2) Add 3 μl of positive control, 3 μl of RNA template extracted from the intestinal tract of sheep to be tested, and 3 μl of negative control to the above-mentioned amplification tubes, centrifuge at 12000 rpm for 5-30 s, put the amplification tubes into the amplification instrument, and Amplification under the set program: pre-denaturation at 94°C for 2 minutes; 94°C for 20s, annealing temperature at 54°C for 30s, 72°C for 20s, 40 cycles. Directly observe the amplification results on the real-time quantitative amplification instrument.

[0063] 4. Result analysis:

[...

Embodiment 3

[0066] Step 1~2 is with embodiment 1;

[0067] 3. Use the method for detecting PRV with the kit of the present invention:

[0068] (1) The total PCR system is 25 μl. In the kit of the present invention, a.2×OneStepRT-PCRbufferIII: 12.5 μL; b.ExTaqHS: 0.5 μL; c. PrimerScriptRTEnzymeMixII: 0.5 μL; d. a total of 3 μl of three primers; f. 5.5 μl of RNase-free water were added to 0.2ml amplification tube;

[0069] (2) Add 3 μl of positive control, 3 μl of RNA template extracted from sheep lymph nodes to be tested, and 3 μl of negative control to the above-mentioned amplification tubes, centrifuge at 12,000 rpm for 5-30 s, put the amplification tubes into the amplification instrument, and Amplification under the set program: pre-denaturation at 94°C for 2 minutes; 94°C for 20s, annealing temperature at 54°C for 30s, 72°C for 20s, 40 cycles. Directly observe the amplification results on the real-time quantitative amplification instrument.

[0070] 4. Result analysis:

[0071] Ju...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reagent kit used for testing Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) of the peste des petits ruminants virus. The reagent kit comprises amplification premixed solution, negative control, positive control and a mixture of SEQIDNO.1 to SEQIDN0.2 amplification primers and an SEQIDNO.3 probe primer. The reagent kit has the advantages that variation of each circular amplicon in PCR (polymerase chain reaction) is tested in real time by the aid of variation of fluorescence signals, a starter template is subjected to quantitative analysis through the relation of Ct values and a standard curve, and the test kit used for testing the peste des petits ruminants virus is high in specificity, good in stability and easy to operate; the test kit has higher sensitivity than common PCR and can be used for testing the peste des petits ruminants virus of low and micro-content samples; the test kit is applicable to not only quantitative analysis of research units but also pathogen testing analysis of prevention and control units at all levels, base veterinary stations and large and medium-sized livestock farms and the like, thereby having good application prospect.

Description

technical field [0001] The invention relates to the technical field of prevention and control of Peste des petits ruminants, specifically a Taqman Real-time RT-PCR (probe method real-time-quantitative polymerase chain reaction) kit for detecting Peste des petits ruminants virus, and the invention also includes the kit usage method. Background technique [0002] Peste des petits ruminants (PPR) is a serious infectious disease caused by Peste des petits ruminants virus (PPRV), which mainly infects small ruminants, especially goats, which are highly susceptible. The virus is a member of the Morbolivirus genus of the Paramyxoviridae family, along with other members of the same genus Rinderpestvirus (Rinderpestvirus, [0003] RPV), canine distemper virus (Canine distemper virus, CDV), seal distemper virus (Porpoise distemper virus, PDV) etc. PPRV mainly invades lymphoid tissue and digestive tract epithelial tissue, and is characterized by sudden fever, secretions from eyes and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/6851C12Q1/70C12Q2531/113C12Q2561/101C12Q2561/113
Inventor刘湘涛吴锦艳田宏陈妍尚佑军王光祥
OwnerLANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI