Specific promoter in leguminous plant root tissue and application thereof

A technology of leguminous plants and promoters, which can be applied to specific promoters and their application fields, and can solve the problems of lack of efficient transformation vectors and the like

Active Publication Date: 2015-06-03
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the construction of transgenic plasmids is one of the bottlenecks of this technology. The main reason is the lack of effective transgenic vectors that can be directed to constitutive expression in legumes or perform tissue-specific expression; and the lack of efficient transformation vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific promoter in leguminous plant root tissue and application thereof
  • Specific promoter in leguminous plant root tissue and application thereof
  • Specific promoter in leguminous plant root tissue and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Example 1. Cloning of root-specific promoters in soybean

[0085] Using the soybean Williams82 genomic DNA extracted by conventional methods as a template, using the following primer pairs (SEQ ID NO.:2-3; with SEQ ID NO:4-5) and KOD high-fidelity enzyme, the promoter was amplified by conventional PCR method , and purified; wherein, the primer pair of SEQ ID NO:4-5 cloned the promoter P1 (SEQ ID NO:1) of the present invention, and the primer pair of SEQ ID NO:2-3 did not clone the specific promoter sequence.

[0086] Forward primer: GGGGTACCGGTCACCCAGATATCATTTGCTGAAA (SEQ ID NO: 2);

[0087] Reverse primer: TCCCCCGGGGCCACAGCCATAGCCATGCTTTC (SEQ ID NO: 3);

[0088] Forward primer: GGGGTACCGTGTTGAGCCACAACCATAGCCA (SEQ ID NO: 4);

[0089] Reverse primer: GGAATTCGTAAAGTGTTATTATGTCGCAAGTAATATTGCTA (SEQ ID NO: 5);

[0090] The PCR amplification conditions are:

[0091] 94℃, 2min;

[0092] 98℃,10sec;

[0093] 60℃,30sec;

[0094] 68℃, 1min;

[0095] 68℃, 7min;

[0096...

Embodiment 2

[0098] Example 2. Construction of GUS expression vector

[0099] The promoter sequence that embodiment 1 obtains and commercially available carrier p1301.POG (Liu Wei etc., the effect of the small G protein RO of Medicago truncatula in symbiotic process: 2.MtROP5 regulates the functional analysis of root hair growth and development, Chinese Agricultural Sciences, 2010 ,43(8)), transformed into Escherichia coli DH5α strain (Shanghai Jiemei Gene Pharmaceutical Technology Co., Ltd., Shanghai) for preservation. After being verified by sequencing, Agrobacterium tumefaciens EHA105 (Beijing Baierdi Biotechnology Company, Beijing) was transformed. The specific steps are as follows:

[0100]1. Enzyme digestion of PCR product and p1301.POG vector

[0101] The PCR product and the p1301.POG vector were double-digested with endonuclease Hind III / Sal1, wherein the digestion reaction conditions of the PCR product were as follows:

[0102] PCR product: 1ug

[0103] 10*fast digest buffer: ...

Embodiment 3

[0132] Embodiment 3. Obtaining of transgenic plants

[0133] The Agrobacterium tumefaciens obtained in Example 2 were used for whole plant transformation of leguminous plants. The leguminous japonicus japonicus was selected to verify the function of the tissue-specific expression vector. Agrobacterium tumefaciens EHA105 containing a tissue-specific expression promoter vector is transfected into plant calli and cultured in a greenhouse to obtain transgenic plants. figure 2 and image 3 The photographs of the transgenic callus and the normal growing japonicus were shown respectively.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a specific promoter in a leguminous plant root system tissue and application thereof. The promoter is particularly suitable for driving the specific expression of exogenous genes in the leguminous plant root tissue, and the expression level of the exogenous genes in other tissues of leguminous plants is extremely low or the exogenous genes are not expressed in the other tissues of the leguminous plants. The expression specificity and specificity of the promoter are very high. The invention further provides constructions, expression kits, carriers and the like with the promoter. For transgenic leguminous plants containing the promoter disclosed by the invention, agronomic traits of the leguminous plants can be specifically improved, so that the influence on the other tissues of the leguminous plants caused by the introduction of the exogenous genes is effectively avoided, the exogenous genes can be specifically expressed in the root tissue, and thus, various related products are obtained.

Description

technical field [0001] The invention belongs to the field of biotechnology. Specifically, the present invention relates to a specific promoter in leguminous plant tissue and its application. Background technique [0002] Legumes are of great economic importance. Among them, soybean is the main source of vegetable protein and edible oil, and it is also the oil crop with the largest output in the world. Soybean is the most nutritious and easily digestible food among legumes, and it is the richest and cheapest source of protein. In many parts of the world today is the staple food of people and animals. For my country, leguminous plants, especially soybeans, are an important economic crop and food crop. [0003] Conventional breeding methods play an important role in quality improvement and breeding of new varieties, but there are also disadvantages such as long breeding period, difficulty in breaking trait linkage, low probability of polygenic recombination, and difficulty ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82C12N5/10A01H5/00
Inventor 李轩余曜戴小密罗利
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap