Leguminous pod-associated tissue-specific promoter and its application
A technology of leguminous plants and promoters, which is applied in the field of specific promoters and its applications, and can solve the problems of lack of efficient transformation vectors, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0088] Example 1. Cloning of pod-associated tissue-specific promoters in soybean
[0089] Using the soybean Williams82 genomic DNA extracted by conventional methods as a template, using the following primer pair (SEQ IDNO.: 2 and 3) and KOD high-fidelity enzyme, the promoter P1 is amplified by conventional PCR method, and purified:
[0090] Forward primer: CATGCCATGGAAATGTGACAAACACTTTCTTCATTT (SEQ ID NO: 2);
[0091] Reverse primer: GGGGTACCAAACAAGAAAACTAAAATACAAAAAACTAAAT (SEQ ID NO: 3).
[0092] The PCR amplification conditions are:
[0093] 94℃, 2min;
[0094] 98℃,10sec;
[0095] 60℃,30sec;
[0096] 68℃, 1min;
[0097] 68℃, 7min;
[0098] 35 cycles.
[0099] PCR products were recovered by agarose gel electrophoresis.
Embodiment 2
[0100] Example 2. Construction of GUS expression vector
[0101]The promoter sequence that embodiment 1 obtains and carrier p1301.POG (Liu Wei etc., the effect of the small G protein RO of Medicago truncatula in symbiotic process: 2.MtROP5 regulates the function analysis of root hair growth and development, Chinese Agricultural Sciences, 2010,43 (8)) were connected and transformed into Escherichia coli DH5α strain (Shanghai Jiemei Gene Pharmaceutical Technology Co., Ltd., Shanghai) for preservation. After being verified by sequencing, Agrobacterium tumefaciens EHA105 (Beijing Baierdi Biotechnology Company, Beijing) was transformed. The specific steps are as follows:
[0102] 1. Enzyme digestion of PCR product and p1301.POG vector
[0103] Use endonuclease NcoI / KpnI to perform double enzyme digestion on the PCR product and the p1301.POG vector, wherein the digestion reaction conditions of the PCR product are as follows:
[0104] PCR product: 1ug
[0105] 10*fast digest buff...
Embodiment 3
[0134] Embodiment 3. Obtaining of transgenic plants
[0135] The Agrobacterium tumefaciens obtained in Example 2 were used for whole plant transformation of leguminous plants. The leguminous japonicus japonicus was selected to verify the function of the tissue-specific expression vector. Agrobacterium tumefaciens EHA105 containing a tissue-specific expression promoter vector is transfected into plant calli and cultured in a greenhouse to obtain transgenic plants. figure 2 and image 3 The photographs of the transgenic callus and the normal growing japonicus were shown respectively.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



