Unlock instant, AI-driven research and patent intelligence for your innovation.

Leguminous pod-associated tissue-specific promoter and its application

A technology of leguminous plants and promoters, which is applied in the field of specific promoters and its applications, and can solve the problems of lack of efficient transformation vectors, etc.

Active Publication Date: 2018-04-27
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the construction of transgenic plasmids is one of the bottlenecks of this technology. The main reason is the lack of effective transgenic vectors that can be directed to constitutive expression in legumes or perform tissue-specific expression; and the lack of efficient transformation vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leguminous pod-associated tissue-specific promoter and its application
  • Leguminous pod-associated tissue-specific promoter and its application
  • Leguminous pod-associated tissue-specific promoter and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Example 1. Cloning of pod-associated tissue-specific promoters in soybean

[0089] Using the soybean Williams82 genomic DNA extracted by conventional methods as a template, using the following primer pair (SEQ IDNO.: 2 and 3) and KOD high-fidelity enzyme, the promoter P1 is amplified by conventional PCR method, and purified:

[0090] Forward primer: CATGCCATGGAAATGTGACAAACACTTTCTTCATTT (SEQ ID NO: 2);

[0091] Reverse primer: GGGGTACCAAACAAGAAAACTAAAATACAAAAAACTAAAT (SEQ ID NO: 3).

[0092] The PCR amplification conditions are:

[0093] 94℃, 2min;

[0094] 98℃,10sec;

[0095] 60℃,30sec;

[0096] 68℃, 1min;

[0097] 68℃, 7min;

[0098] 35 cycles.

[0099] PCR products were recovered by agarose gel electrophoresis.

Embodiment 2

[0100] Example 2. Construction of GUS expression vector

[0101]The promoter sequence that embodiment 1 obtains and carrier p1301.POG (Liu Wei etc., the effect of the small G protein RO of Medicago truncatula in symbiotic process: 2.MtROP5 regulates the function analysis of root hair growth and development, Chinese Agricultural Sciences, 2010,43 (8)) were connected and transformed into Escherichia coli DH5α strain (Shanghai Jiemei Gene Pharmaceutical Technology Co., Ltd., Shanghai) for preservation. After being verified by sequencing, Agrobacterium tumefaciens EHA105 (Beijing Baierdi Biotechnology Company, Beijing) was transformed. The specific steps are as follows:

[0102] 1. Enzyme digestion of PCR product and p1301.POG vector

[0103] Use endonuclease NcoI / KpnI to perform double enzyme digestion on the PCR product and the p1301.POG vector, wherein the digestion reaction conditions of the PCR product are as follows:

[0104] PCR product: 1ug

[0105] 10*fast digest buff...

Embodiment 3

[0134] Embodiment 3. Obtaining of transgenic plants

[0135] The Agrobacterium tumefaciens obtained in Example 2 were used for whole plant transformation of leguminous plants. The leguminous japonicus japonicus was selected to verify the function of the tissue-specific expression vector. Agrobacterium tumefaciens EHA105 containing a tissue-specific expression promoter vector is transfected into plant calli and cultured in a greenhouse to obtain transgenic plants. figure 2 and image 3 The photographs of the transgenic callus and the normal growing japonicus were shown respectively.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a specific promoter in relevant tissues of leguminous plant pods and its application. The promoter is particularly suitable for driving the specific expression of exogenous genes in pod-related tissues of legumes, such as pods or cotyledons, while the expression level is very low or not expressed in other tissues of legumes. The expression specificity and specificity of the promoter are very high. The present invention also provides constructs, expression cassettes, vectors and the like having the promoter. The transgenic legume plant containing the promoter of the present invention can specifically improve the agronomic traits of the legume plant, effectively avoid the impact of foreign gene introduction on other tissues of the legume plant, and can also specifically express the foreign gene in relevant tissues of the pod , so as to obtain various related products.

Description

technical field [0001] The invention belongs to the field of biotechnology. Specifically, the present invention relates to a specific promoter in leguminous plant tissue and its application. Background technique [0002] Legumes are of great economic importance. Among them, soybean is the main source of vegetable protein and edible oil, and it is also the oil crop with the largest output in the world. Soybean is the most nutritious and easily digestible food among legumes, and it is the richest and cheapest source of protein. In many parts of the world today is the staple food of people and animals. For my country, leguminous plants, especially soybeans, are an important economic crop and food crop. [0003] Conventional breeding methods play an important role in quality improvement and breeding of new varieties, but there are also disadvantages such as long breeding period, difficulty in breaking trait linkage, low probability of polygenic recombination, and difficulty ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82C12N5/10A01H5/00A01H6/46
Inventor 李轩余曜戴小密谢芳
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More