Flanking sequence of genetically modified insecticidal maize HKG60 exogenous insert fragment and detecting method of flanking sequence

A technology of genetically modified corn and insect-resistant corn, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc.

Active Publication Date: 2016-07-20
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the literature mentioned above, although all the Btcry1Ah genes were transformed, the factors affecting gene expression also included promoters, regulatory sequences, different codon optimized forms of genes, screening marker genes and different transformation methods, resulting in The genetically modified materials are different, the expression levels of foreign genes are also very different, and the positions of foreign genes inserted into the genome of maize are also different.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Flanking sequence of genetically modified insecticidal maize HKG60 exogenous insert fragment and detecting method of flanking sequence
  • Flanking sequence of genetically modified insecticidal maize HKG60 exogenous insert fragment and detecting method of flanking sequence
  • Flanking sequence of genetically modified insecticidal maize HKG60 exogenous insert fragment and detecting method of flanking sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1, the acquisition of transgenic corn event HGK60

[0047] 1. Construction of plant expression vectors for maize transformation

[0048] The plant expression vector used in this study is pmAhG2 (preserved at the Institute of Biotechnology, Chinese Academy of Agricultural Sciences), see figure 1 . The backbone of the plant expression vector is pCAMBIA3300, and the ubiquitin promoter from maize ubiquitin protein, the transformed Btcry1Ah gene (patent number: ZL200410009918.9, see SEQ ID NO: 3) and the NOS terminator are inserted into the multi-cloning of the vector, and the screening of the insertion is performed at the same time The marker gene is the G2-aroA gene, and the G2-aroA gene is a glyphosate-tolerant strain isolated from long-term glyphosate-polluted soil—the encoded EPSPS enzyme ( Patent No.: ZL03826892.2), the G2-aroA gene is driven by the maize ubiquitin promoter, the terminator is NOS, the screening marker gene expression cassette is connected wit...

Embodiment 2

[0125] Example 2. Analysis of the foreign gene insertion site of the transgenic maize event HGK60

[0126] According to the analysis of the Southern blot results of the transgenic maize event HGK60: as image 3 There are three BamHI restriction sites in the inserted expression cassette, and when the 831bp Digoxigenin-labeled m4-cry1Ah gene fragment is used as probe 1 for hybridization, no matter the foreign fragment There are several copies inserted, all of which will be hybridized to obtain a fragment with a size of 4.6Kb ( Figure 4 ), the three samples showed the same hybridization band; there was one HindⅢ restriction site and three SacⅠ restriction sites in the inserted expression cassette, and these restriction sites were all located at the 3' end of the cry1Ah gene, which would not The identification of the copy number of the cry1Ah gene was affected, and the result was that both HindⅢ and SacⅠ digestion products hybridized with 2 bands ( Figure 4 ), which proved to ...

Embodiment 3

[0136] Example 3 Obtaining the 5' and 3' flanking sequences of the transgenic event HGK60 by chromosome walking

[0137] Foreign fragments inserted into the maize genome such as Figure 6As shown, two copies of the modified cry1Ah gene and the modified G2-aroA marker gene are inserted in series on the maize chromosome, because the ubiquitin promoter is derived from the maize ubiquitin gene, which is contained in the maize genome, so It is not easy to obtain the flanking sequence by chromosome walking method, so primers were designed starting from the G2-aroA gene and amplified from the 5' end to the 3' end of G2-aroA.

[0138] Specific primers were designed as follows:

[0139] SP1: TCCTCGCAGCCTTCAACAATACTCCC (on the G2-aroA gene)

[0140] SP2: GGTCTCAGGCATTCGCATTCAG (located on the G2-aroA gene)

[0141] SP3: AATCCTGTTGCCGGTCTTGCGATGA (on nos)

[0142] The Chromosome Walking Kit was purchased from TaKaRa Company (GenomeWalkingKit). There were 4 degenerate primers in the k...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a flanking sequence of a genetically modified insecticidal maize HKG60 exogenous insert fragment and a detecting method of the flanking sequence, and belongs to the technical field of biology.A plant expression carrier pmAhG2 containing a Bt cry1Ah gene is established, a genetically modified maize plant genetically modified by the Bt cry1Ah gene is obtained, and a genetic modification event HGK60 with a remarkable ostrinia nubilalis resistant effect is screened out; the maize event HGK60 contains an insert gene sequence on a first chromosome of a maize genome, and the 5' flanking sequence and the 3' flanking sequence of the maize genome are as shown in SEQ ID NO:1 and SEQ ID NO:2 respectively.A primer can be designed according to the DNA of a combination area where the insert sequence and the flanking sequences of maize are introduced, and the event HGK60 is specifically, qualitatively and quantitatively detected.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to the detection of transgenic insect-resistant corn plants. Background technique [0002] Corn (Zeamays L.) is an important food crop, feed and industrial raw material, and plays a very important role in the national economy. Insect pests have always been one of the important factors restricting corn production. There are about 350 species of corn pests worldwide, among which the Lepidoptera corn borer is the most serious and widely distributed. In my country, corn borer damage can occur from north to south for 1 to 7 generations a year. The harm of corn borer in spring corn in general years can cause about 10% of corn yield reduction, and the yield loss caused by major occurrence years can reach more than 30%. At the same time, when Lepidoptera pests attack corn ears, they will produce mycotoxins, which have many adverse effects on the health of livestock, and the toxins are suspecte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13
Inventor郎志宏黄大昉汪海朱莉李圣彦宋苗李秀影戴军
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI