Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene marker for screening pre-job entry of lead exposure worker, and application thereof

A gene marker and biomarker technology, applied in the field of biotechnology, can solve problems such as differences in blood lead concentration and susceptibility to lead exposure, and achieve the effect of simple operation and high sensitivity

Active Publication Date: 2017-04-26
JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although the pathogenic factors of lead poisoning have been relatively clear, in the same environment and at the same exposure level, individuals respond differently to lead, and there are great differences in individual blood lead concentrations, which suggests that our individual response to lead is not the same. Susceptibility differences exist with exposure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene marker for screening pre-job entry of lead exposure worker, and application thereof
  • Gene marker for screening pre-job entry of lead exposure worker, and application thereof
  • Gene marker for screening pre-job entry of lead exposure worker, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Selection of research subjects

[0021] The subjects of this study were lead-related occupational exposure workers from 8 lead-acid battery industries in Jiangsu Province, a total of 1200 people, all of whom were Han nationality, and none of them used lead-related personal protective equipment during work. Exclusion criteria for research subjects: 1) Long-term use of lead-containing drugs or food, use of lead-containing containers to carry objects, or use of lead-containing cosmetics and other living lead exposure history; 2) Patients with abnormal liver and kidney functions; 3) Patients with blood diseases. This study was approved by the Ethics Committee of the Jiangsu Provincial Center for Disease Control and Prevention, and all research subjects signed the relevant informed consent and authorized to participate in the research of this project.

[0022] Peripheral blood collection, pretreatment and extraction

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene marker for screening the pre-job entry of a lead exposure worker. A biomarker is an XPO5 gene 3'UTR area rs2257082 polymorphic site; the XPO5 gene 3'UTR area rs2257082 polymorphic site is as follows: TGGTCCATCTGGCCTTCCAGATATA[C / T] GAGGCACTGGTGAGTGGGGAAGGCA. TC and CC genetypes in the XPO5 gene 3'UTR area rs2257082 polymorphic site of a testee are detected so as to judge whether the testee belongs to a lead-susceptible high risk group. According to the gene marker provided by the invention, DNA (Deoxyribose Nucleic Acid) is extracted from the blood of lead-endurance workers and the blood of lead-sensitive workers with matched ages, genders and the like for the first time, a plurality of sites which participate in miRNA (Micro Ribonucleic Acid) nuclear export mature access relevant genes are detected, and a situation that the mononucleotide polymorphism of XPO5 gene 3'UTR area rs2257082 polymorphic site and the lead susceptibility have dependency is finally verified so as to serve as the gene marker for the pre-job entry of the lead exposure worker. The gene marker has the advantages of simpleness in operation and high sensitivity and is suitable for screening susceptible population on a large scale, and a basis is provided for the pre-job entry of the lead exposure worker.

Description

technical field [0001] The invention belongs to the field of biotechnology, relates to the application of DNA in blood cells, and discloses a biomarker for pre-employment screening of lead-exposed workers and an application thereof. Background technique [0002] Lead is ubiquitous because it is non-degradable in the environment. It can enter the body through the digestive tract, respiratory tract and other ways to affect the functions of multiple systems such as nerves, digestion, and hematopoiesis, causing damage to the body. (Muntner, P., 2, Menke, A., DeSalvo, K.B., 2, Rabito, F.A. & Batuman, V 2005) There is no threshold for neurodevelopmental toxicity caused by lead. Some studies have reported that even if the blood lead level is lower than 100μg / L There was neurodevelopmental toxicity (Akesson, A et al 2005). Therefore, searching for susceptibility markers of lead poisoning is helpful for early detection of lead poisoning susceptible populations. In previous studies,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/156
Inventor 张恒东朱宝立徐酩陈彦王建锋王博深赵秋妮钱秀荣
Owner JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More