41 results about "Lead exposure" patented technology

The invention discloses a plant lactobacillus feed capable of relieving tilapia lead toxicity, and belongs to the technical field of feed. The feed is a finished feed probiotics granulated feed having the viable bacterial number of more than 10<8> cfu/g and prepared by a way of adding a bacterial agent obtained by carrying out centrifuging concentration or freeze drying and microcapsule embedding on CGMCC 5494 strains into an aquatic animal feed pre-mix material in a form of a feed additive, and then granulating or pre-granulating and then spraying probiotics on a carrier to obtain the feed. The feed obtained by the method can increase the growth rate of tilapia, increases the intestinal tract digestive enzyme activity of the lead-exposure tilapia, reduces the lead content in bodies of the lead-exposure tilapia, relieves the oxidative stress damage in the bodies of the lead-exposure tilapia, improves the activity of aminolevtllinic acid dehydratase in the bodies of the lead-exposure tilapia, improves the lysozyme activity and myeloperoxidase activity of the lead-exposure tilapia, relieves the cell and genetic toxicity of the lead-exposure tilapia, and better has application prospects.

The invention provides an ultraviolet LED exposure machine optical exposure illumination system and an ultraviolet LED exposure machine adopting the system. The system comprises at least one light source mounting plate, a collimation lens, and an exposure illumination matrix arrangement device used for fixing the distance of the collimation lens and the light sources on the light source mounting plate. Multiple rows of ultraviolet LED light sources are sequentially arranged with equal spaces on the light source mounting plate. A distance between centers of two adjacent ultraviolet LED light sources in each row is A, a distance between centers of ultraviolet LED light sources in adjacent rows and in a same column is B, and B=A/row number. Every two adjacent ultraviolet LED light sources are arranged with equal spaces. According to the invention, the improvement on exposure uniformity and the reduction of light source divergence angle are adopted as basis. Phenomena such as non-uniform line thickness, inconsistent resolution on an entire plate, or broken line caused by non-uniform irradiation of the optical exposure illumination system are avoided.

The invention provides a same-tower double-circuit line lightning shielding failure lightning protection performance analysis method considering a shielding effect among leads. An electrical geometricmodel based on same-tower double-circuit line lightning shielding failure lightning protection performance analysis is used to calculate a lead exposure distance, the critical lightning currents of the leads at different exposure distances, and a lead lightning shielding failure flashover rate. According to the magnitude of a lightning current, the same-tower double-circuit line lightning shielding failure lightning protection performance considering the shielding effect among the leads is analyzed based on four conditions. In the analysis method, a mutual lightning shielding failure shielding effect among the leads is considered, and a same-tower double-circuit line lightning shielding failure lightning protection performance analysis model considering the shielding effect among the leads is established, which is an effective supplement to the existing method of calculating the same-tower multi-circuit line lightning shielding failure lightning protection performance.

A scanned ultraviolet-light emitting diode (UV-LED) exposure device, exposing a large area by using a periodic UV-LED exposure light source with a fixed rate in an exposure task without a need of stopping movement of the device, so as to periodically repeat a use of an exposure light source to increase a use efficiency of the energy source, resulting in an improved uniformity of exposure, with the LEDs alternatively arranged policy, which further results in an improved yield. In addition, the overall design of the upper and lower exposure stations and the periodic moving ring assembly sufficiently employs the available space, and results in a reduced volume, a corresponding production space, energy consumption and production cost.

The invention relates to an LED lamp which comprises a frame body. The LED lamp is characterized in that at least one LED exposure prevention device is arranged in the frame body; the LED exposure prevention device comprises a plurality of first sheltering bars and a plurality of second sheltering bars, wherein the first sheltering bars and the second sheltering bars are arranged on the frame body, the first sheltering bars are transversely arrayed, and the second sheltering bars are vertically arrayed; the first sheltering bars and the second sheltering bars are connected at junctions; circular truncated cone protrusions are arranged on the junctions, and a reflective device is arranged on the surface of each circular truncated cone protrusion; a plurality of LEDs are arranged on the inner side of the frame body and above the first sheltering bars and the second sheltering bars, and light sources of the LEDs face towards the inside of the frame body. Compared with the prior art, the LED lamp has the advantages that indoor air and outdoor air can be communicated when a bather has a hot bath in summer, and meanwhile, the situation that the bather is probably exposed is avoided; the problems that ventilation of a bathroom is poor and the bather feels muggy because the bather needs to close a window in summer in order not to be exposed are solved.

The invention relates to a novel anti-welding double-sided LED exposure machine, including the frame and conveyor rails, the conveying slide rail is fitted with a frame, characterized by, the machineframe is arranged at the upper and lower parts of the conveying slide rail and is provided with an LED lamp source, the frame includes a lower frame that cooperates with the conveyor rail, the lower frame is hinged with an upper frame, the lower frame is provided with a middle frame which bears the product, and the lower part of the middle frame is provided with a PIN positioning device which is matched with the alignment hole on the middle frame and the product, the lower frame is provided with an alignment device capable of making the middle frame movable, An object of the present inventionis to provide a novel anti-welding double-sided LED exposure machine, A 3-layer frame is adopt, that upper image of the PCB is aligned with the middle frame image through a PIN position device, the middle frame is moved through the aligning device, the low image of the PCB board is aligned with the upper frame image, two or two alignments of the four images are realized, and the welding-proof double-sided LED exposure can be realized, the processing efficiency is improved, and the cost is reduced.

The invention discloses a novel large-table-board LED exposure machine. The machine comprises a tank, an adjustable handle device, batteries, connecting rods, moving wheels, a transmission motor, exposure lamps, a cooling fan device, a rain baffle device and a mounting plate, wherein the adjustable handle device is in shaft connection with the left side of the tank. Movement is more flexible due to the arrangement of the transmission motor and the moving wheels; a protective casing, fan blades, a rotating table, mounting bolts, fixing plates, a rotating rod and a rotating motor are arranged, so that the cooling effect of the exposure machine is improved; the fan blades are made of PVC plastic, accordingly, corrosion is prevented, and the service life is prolonged; the protective casing ismade of PE plastic, and maintenance cost and deadweight are reduced; carrying and moving are convenient as a result of arrangement of a handle, an extension pipe, an adjusting bolt, a rotating shaft and a fixing pipe; rainwater is prevented from entering the exposure machine to damage the exposure machine by the aid of a hinge, a connecting plate, a baffle, auxiliary tapes and main tapes.

Disclosed is an image forming apparatus composed of a combination of multi-layered electrophotographic photoreceptor wherein an undercoat layer is made of at least fine titanium oxide particles and a binder resin and has a thickness of 3 μm or less and the fine titanium oxide particles are surface treated with alumina and silica and have a number average primary particle size of 20 nm or less, and exposing means by LED exposure. Thus, an electrophotographic photoreceptor having good balance between dispersibility of titanium oxide and electrical insulation properties is obtained and image fog does not occur under high temperature and high humidity environment and also excellent image quality can be maintained during continuous printing under low temperature and low humidity environment.

The invention provides a radiogram marking machine and marking method. The radiogram marking machine comprises a transformer used for converting high-voltage alternating current into low-voltage direct current; two ends of the transformer are respectively connected with a power supply and a microswitch; the microswitch is connected with a time relay; the time relay is connected with a light modulator; the light modulator is connected with a LED exposure lamp and a signal lamp; an exposure screen is arranged to face the LED exposure lamp; and one side of the exposure screen is provided with a spring bearer plate used for positioning a marking scope and triggering the microswitch. The invention also provides a radiogram marking method. According to the method, a radiographic testing photograph having undergone exposure is subjected to secondary exposure to visible light so as to mark the photograph with a marking; after exposure to rays, the photograph still has unreacted ions; and the exposure screen gives off character-shape light rays to irradiate the film base of the photograph, so compounding of the unreacted ions is promoted and imaging is realized so as to accomplish marking of the photograph. The radiogram marking machine provided by the invention is simple in structure, convenient to install and maintain and low in price, and improves the production efficiency of ray detection and the automation level of flaw detection.

The invention relates to a scanning UV-LED (Ultraviolet Light Emitting Diode) exposure device, which comprises an exposure unit, an UV-LED illumination unit and a circulating periodic moving ring. According to the scanning UV-LED exposure device, anUV-LED exposure light source doing periodic circulation at a fixed velocity is used, and in the scanning exposure process in a large-area target region, the moving does not need to stop; the goal of improving the use efficiency of energy through constantly, circularly and repeatedly utilizing the exposure light source is achieved; in addition, the radiant illumination uniformity of an LED array light source is enhanced through staggered arrangement, so that the exposure uniformity is improved, and further, the qualification rate of products is effectively improved. In addition, through structural designs of upper and lower exposure platforms and the circulating periodic moving ring, the size of the device can be reduced; the production space and the energy consumption are reduced, so that the production cost is reduced; the circulating periodic moving ring is used for driving the LED array light source, so that a workpiece can sufficiently utilize the space between the upper and lower exposure platforms and the circulating periodic moving ring, and the exposure of the upper and lower exposure platforms can be simultaneously carried out; energy sources can be saved; and in addition, the production speed can be effectively and relatively increased, so that the productive efficiency is improved.

The invention relates to an LED (Light Emitting Diode) luminous lamp. The LED luminous lamp comprises a frame body, wherein the frame body is at least internally provided with an LED exposure-prevention device, wherein the LED exposure-prevention device comprises a plurality of reflection bars which are arranged on the frame body and connected with two sides of the frame body; the reflection bars are vertically arranged, and the distances between the adjacent reflection bars are equal; each reflection bar is provided with a reflecting device; the reflection bar comprises an upper reflection bar and a lower reflection bar; the upper reflection bar and the lower reflection bar are connected together, and an included angle is formed between the upper reflection bar and the lower reflection bar; a supporting rod is arranged in front of the reflection bar; both ends of the supporting rod are connected with the two sides of the frame body; the supporting rod is provided with a plurality of LED lamps which are arranged in order and at equal intervals; a light source of each LED lamp faces to the reflection bar; and the distance between the adjacent reflection bars are between 1 cm and 2 cm. Compared with the prior art, a bather can keep ventilation with outdoors when taking a hot bath in summer, and meanwhile the bather can be prevented from being exposed possibly; and the problem that the bathroom is poor in ventilation and extremely stuffy in summer since the window must be closed in order to prevent exposure is solved.

The invention discloses a wiring device for a magnetic suspension bearing, a compressor and refrigeration equipment. The magnetic suspension bearing comprises a control winding with a first wiring endand a second wiring end, a first conductive structure and a second conductive structure are arranged in the wiring device, the first conductive structure is conductively connected with the first wiring end, and the second conductive structure is conductively connected with the second wiring end, wherein the first conductive structure is provided with an external connection end connected with an outer power source. According to the provided wiring device for the magnetic suspension bearing, the wiring and wire guiding operation steps are simplified, the conductive structures are arranged in the wiring device, the problem about lead exposure cannot happen, accordingly, the service life of leads is prolonged, and the running reliability of the magnetic suspension bearing is improved.

The invention relates to the technical field of circuit board exposure, development and etching, in particular to a mechanism capable of improving parallel light ejection of an LED exposure machine in an exposure process. The mechanism is achieved through the technical scheme as follows: the mechanism capable of improving parallel light ejection of the LED exposure machine comprises a PCB, a light source, a reflection cup and a light guide cover, wherein the reflection cup is fixed on the PCB; the light source is fixed on the PCB at a focus position in the reflection cup; and the light guide cover is fixed at an open end of the reflection cup and the light guide cover and the reflection cup are in the same axis. The light guide cover is added to a travel road of the light source for emitting light, so that a plurality of unparallel light rays are restrained in the light guide cover in the working process and are changed into parallel light rays through a light-absorbing material on the light guide cover; the parallel light rays are exposed, developed and etched after being irradiated to obtain a line which is equal to a film in width; and the working accuracy of the overall PCB is ensured.

The invention discloses a manual LED exposure device which comprises a box body, thread spindles symmetrically arranged at both upper and lower sides inside the box body and a base mounted at the bottom of the box body. Chutes are formed in an embedded mode at both upper and lower sides of the box body; limiting blocks and auxiliary blocks are symmetrically mounted on the inner walls at both upperand lower sides of the box body; the limiting blocks and the auxiliary blocks are respectively mounted at both ends of the thread spindles; the auxiliary blocks sleeve one ends of the thread spindles; the other ends of the thread spindles are embedded in the limiting blocks; moving blocks are also arranged between the limiting blocks and the auxiliary blocks; the moving blocks sleeve the thread spindles and are clamped with the thread spindles by screw threads; sliding blocks are arranged at the upper ends of the moving blocks; the sliding blocks are in sliding connection with the chutes; LEDlamp panels are mounted at the bottoms of the moving blocks; the LED lamp panels are sleeved with lampshades; concave clamping strips are symmetrically mounted on the inner walls at both left and right sides of the box body; and an exposure plate is clamped between the concave clamping strips.

The invention discloses a UV-LED exposure light source bracket. The UV-LED exposure light source bracket comprises a supporting rod and a rotary rod, wherein the top of the supporting rod is fixedly connected with a fixed table board; the lower surface of the fixed table board is fixedly connected with a screw; the outer surface of the screw is separately in threaded connection with an upper nut and a lower nut; a gasket is fixedly connected between the upper nut and the lower nut; the two sides of the gasket are fixedly connected with slide blocks; one side of the supporting rod is fixedly equipped with a slide slot; the slide blocks are in sliding connection with the inner wall of the slide slot; a long branch which is fixedly connected to one side of the supporting rod is arranged on the bottom of the gasket; a light reflecting mirror sleeves the outer surface of the rotary rod; one end of the rotary rod is welded with a handle; and the back surface of the supporting rod is fixedlyconnected with a short branch. According to the UV-LED exposure light source bracket disclosed by the invention, the rotary rod, a handle, a pointer, a protractor, a screw, the upper nut, the lower nut, the gasket, the slide slot and the slide blocks are arranged, so that the problems that the angle of the light reflecting mirror is un-adjustable, collimation degree and uniformity of parallel light and height of an exposure light source are un-adjustable, and light source regulating efficiency is low are solved.

The invention discloses a gene marker for screening the pre-job entry of a lead exposure worker. A biomarker is an XPO5 gene 3'UTR area rs2257082 polymorphic site; the XPO5 gene 3'UTR area rs2257082 polymorphic site is as follows: TGGTCCATCTGGCCTTCCAGATATA[C/T] GAGGCACTGGTGAGTGGGGAAGGCA. TC and CC genetypes in the XPO5 gene 3'UTR area rs2257082 polymorphic site of a testee are detected so as to judge whether the testee belongs to a lead-susceptible high risk group. According to the gene marker provided by the invention, DNA (Deoxyribose Nucleic Acid) is extracted from the blood of lead-endurance workers and the blood of lead-sensitive workers with matched ages, genders and the like for the first time, a plurality of sites which participate in miRNA (Micro Ribonucleic Acid) nuclear export mature access relevant genes are detected, and a situation that the mononucleotide polymorphism of XPO5 gene 3'UTR area rs2257082 polymorphic site and the lead susceptibility have dependency is finally verified so as to serve as the gene marker for the pre-job entry of the lead exposure worker. The gene marker has the advantages of simpleness in operation and high sensitivity and is suitable for screening susceptible population on a large scale, and a basis is provided for the pre-job entry of the lead exposure worker.