Check patentability & draft patents in minutes with Patsnap Eureka AI!

Replication-type recombinant adenovirus hadv-5 vector system and its application

A technology of recombinant adenovirus and vector system, which is applied in the field of replicative recombinant adenovirus HAdV-5 vector system, can solve the problem that the virus cannot replicate, and achieve the effect of wide application

Active Publication Date: 2021-02-02
STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] There are currently a variety of commercial HAdV-5-based replication-deficient vector systems, however, the virus cannot replicate after this vector infects target cells and only functions as a gene transfer vector
There is no report on commercial replicating HAdV-5 vector system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Replication-type recombinant adenovirus hadv-5 vector system and its application
  • Replication-type recombinant adenovirus hadv-5 vector system and its application
  • Replication-type recombinant adenovirus hadv-5 vector system and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1, construction of backbone plasmid pKAd5

[0054] The schematic diagram of the construction of the backbone plasmid pKAd5 is shown in figure 1 . Under standard polymerase chain reaction (PCR) conditions, using the pShuttle-CMV plasmid (purchased from Stratagene) as a template, 1710KAd5F: caatccaaaa taaggtatattattgatgat g ttaattaa g atcccgagcg gtatcag (the underline indicates the PacI restriction site), 1710KAd5R: aatccaaaat aaggtatatt attgatgatg ttaattaa tg gaacaacact caaccctat (the underline indicates the PacI restriction site) (the above primer was synthesized by BGI) was used as primer to amplify the 2540bp fragment ORI-KAN (SEQ ID NO: 2). About 30 bp at both ends of this fragment are identical to the ITR sequence of HAdV-5 genome. Mix the ORI-KAN fragment recovered by electrophoresis with wild-type HAdV-5 (VR-1516, purchased from ATCC) genomic DNA (see Genbank accession number: AY339865 for the sequence), and then add an equal volume of DNA assembly...

Embodiment 2

[0056] Embodiment 2, construction of intermediate plasmid pMDXE3YA

[0057] In order to facilitate the transformation of the adenovirus E3 region, the NdeI fragment containing the E3 region was isolated from the backbone plasmid pKAd5 constructed in Example 1, and E3 was replaced with the YFP coding region and the SV40 polyA signal region, and the plasmid obtained after the replacement was named is pMDXE3YA.

[0058] figure 2 A schematic diagram of the construction of the intermediate plasmid pMDXE3GA is shown.

[0059] The construction process of the intermediate plasmid pMDXE3GA is as follows:

[0060] 1) NdeI / EcoRI double digestion of the backbone plasmid pKAd5 constructed in Example 1, electrophoresis recovery of 7776bp fragment (NdeI-EcoRI, the sequence can be found in SEQ ID NO: 3, due to the retention of the complete NdeI site and EcoRI site , actually 7783bp).

[0061] 2) Using the pMD-18T plasmid as a template (purchased from Takara Company), using 1710pMDxE3Y1: ...

Embodiment 3

[0064] Embodiment 3, construction of shuttle plasmid pKNXE3M

[0065] The target gene replacement operation on the intermediate plasmid pMDXE3YA involves multi-step PCR and DNA assembly, which is cumbersome. In order to further simplify the cloning of the target gene, the target gene region of the E3 region was isolated again from the intermediate plasmid pMDXE3YA, and a multiple cloning site was added to construct a smaller shuttle plasmid pKNXE3M. image 3 A schematic diagram of the construction of the shuttle plasmid pKNXE3M is shown.

[0066] The construction method of shuttle plasmid pKNXE3M is as follows: with pmCherry-N1 plasmid (purchased from Clontech company) as template, with 1712KNEOf:ggcc gaattc cacttttcgg ggaaatgtgc (the underline indicates the EcoRI restriction site) and 1712KNEOr: ggcc gaattc cgcaggaaag aacatgtgag (the underline indicates the EcoRI restriction site) is used as a primer to amplify a 2600bp fragment, after electrophoresis recovery, it is di...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a replication-type recombinant adenovirus HAdV‑5 vector system, which includes a backbone plasmid pKAd5, an intermediate plasmid pMDXE3YA and a shuttle plasmid pKNXE3M. Clone the coding region of the target gene into the multiple cloning site of the shuttle plasmid, digest the shuttle plasmid carrying the target gene with EcoRI, and replace the corresponding part of the intermediate plasmid with the resulting fragment; then digest the newly constructed intermediate plasmid with NdeI, and replace it with the resulting fragment The corresponding part of the backbone plasmid can obtain the recombinant adenovirus plasmid; the PacI linearized recombinant adenovirus plasmid transfects 293 cells, and can prepare the recombinant HAdV‑5 adenovirus controlled by the HAdV‑5 major late promoter (MLP) to express the target gene . The recombinant adenovirus can replicate and proliferate in various human cells, and is a replication-type virus. It is expected to have broad application prospects in the research and development of oral vector vaccines for animals.

Description

technical field [0001] The invention belongs to the field of recombinant vaccines, in particular, the invention relates to a replicative recombinant adenovirus HAdV-5 vector system and its application. Background technique [0002] Oral vaccines have many advantages [1,2] . Intramuscular injection of vaccines requires the participation of medical staff and multiple immunizations, which requires a large amount of vaccines, and the purification process is relatively complicated and costly. Oral vaccines can make up for the shortage of intramuscular vaccines. The dose of live vaccines is small, no strict purification is required, and the cost is low; the vaccination is convenient, no professional medical staff is required, and the compliance is good. The mucous membrane is the entry barrier for pathogens, and oral vaccines can trigger strong mucosal immunity, directly intercepting pathogens outside the body; attenuated oral vaccines can trigger strong cellular immunity, which...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/861
CPCC12N15/86C12N2710/10043
Inventor 鲁茁壮刘红军邹小辉
Owner STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More