Unlock instant, AI-driven research and patent intelligence for your innovation.

Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for porcine intestinal coronavirus

A detection kit and coronavirus technology, applied in the detection/inspection of microorganisms, resistance to vector-borne diseases, biochemical equipment and methods, etc., can solve problems such as difficult differential diagnosis, serious harm, and difficult diagnosis of diarrheal diseases, and achieve Easy to collect and save, wide audience, easy to promote the effect

Active Publication Date: 2018-11-23
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These viruses are currently the main pathogens that cause viral diarrhea in pig herds or pig farms. They are very harmful, and there are mixed infections. The lethality rate of piglets ranges from 50% to 100%, causing great economic losses to the pig industry.
In addition, the clinical symptoms, pathological changes, and epidemic characteristics of viral diarrhea caused by the above-mentioned viruses are very similar. It is difficult to make a differential diagnosis based on clinical diagnosis alone, which often leads to misdiagnosis. Therefore, the prevention and control of the disease and its early diagnosis and differential diagnosis are particularly important
However, the complex etiology of diarrheal diseases and the limitations of existing diagnostic methods make it difficult for grassroots veterinarians and farms to diagnose diarrheal diseases, making the prevention and control of diarrheal diseases difficult to target and prescribe the right medicine
The most fundamental reason for this phenomenon is the lack of applicable fast, accurate and convenient commercial detection methods
For a long time, the detection kits for porcine viral diarrhea are mainly based on the traditional serological detection methods of porcine transmissible gastroenteritis virus (TGEV) and porcine epidemic diarrhea virus (PEDV). Two major changes occurred in the diarrhea epidemic: first, it mainly caused disease and death of suckling piglets, whose immune system was not yet fully developed, and failed to effectively produce serum antibodies; second, a highly pathogenic Virulent porcine deltacoronavirus and porcine enteric alphacoronavirus, there are no mature detection methods for these two viruses
It can be seen that the existing detection kits for detecting porcine viral diarrhea cannot meet the needs of current disease diagnosis, so there is an urgent need to develop a commercial detection kit that meets the current epidemic trend, and there is currently no one-time detection, diagnosis, Commercial kits for the identification and quantitative detection of the above four pathogens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for porcine intestinal coronavirus
  • Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for porcine intestinal coronavirus
  • Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for porcine intestinal coronavirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1. Design and synthesis of 4-fold fluorescence quantitative PCR primers and probes for porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine deltacoronavirus and porcine intestinal alphacoronavirus

[0050] Using the sequence comparison of the known porcine epidemic diarrhea virus M protein, porcine transmissible gastroenteritis virus N protein, porcine deltacoronavirus M protein and porcine intestinal alphacoronavirus N protein gene sequence, find out the conserved region, and then use Oligo6 software designed 4-fold fluorescent quantitative PCR primers, and the primer sequences were synthesized by Suzhou Jinweizhi Technology Co., Ltd. The 4 pairs of primers are:

[0051] Primer name and label

sequence

SEQ ID No. 1 (PEDV-F)

GATACTTTGGCCTCTTGTGT

SEQ ID No.2 (PEDV-R)

CACAACCGAATGCTATTGACG

SEQ ID No.3 (TGEV-F)

CAGATAGAAGTCACGTTCACA

SEQ ID No.4 (TGEV-R)

TCTCTGTTCTTTTGCCAC

...

Embodiment 2

[0055] Example 2. Determination of Primer and Probe Specificity

[0056] Use the primers for amplifying porcine enteric coronavirus to amplify the corresponding fragments, clone the amplified fragments into the T vector, screen the positive plasmids through transformation, plasmid extraction, enzyme digestion and PCR identification, measure the concentration, and calculate the copy number. Four kinds of positive plasmids of porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine deltacoronavirus and porcine enteric alphacoronavirus were divided into 1×10 7 , 1×10 6 Equal concentrations were diluted 10 times, and equal copy numbers were mixed, and then amplified with four pairs of primers and corresponding probes to test the specificity of the primers and probes. The results show that the corresponding primers and probes for porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine deltacoronavirus and porcine intestina...

Embodiment 3

[0057] Embodiment 3. Determination of reaction system and reaction conditions

[0058] The optimal concentration of primers and probes for screening 4-fold fluorescent quantitative PCR amplification reactions is as follows: Figure 19 , 20 shown; based on this, all the primers were mixed to screen for the optimal reaction concentration of each primer. The optimal primer and probe reaction concentrations of the 4-fold fluorescent quantitative PCR detection method were finally determined by optimization screening as follows:

[0059]

[0060] The reaction system is:

[0061]

[0062] The reaction conditions are:

[0063]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for porcine intestinal coronavirus. The kit comprises eight six-base random reverse transcription primers having sequences shown in SEQ ID No. 1-SEQ ID No. 8, and four probe primers having sequences shown in SEQ ID No. 9-SEQ ID No. 12. The primers in the kit provided by the invention are specific primers which designed according to a highly conserved region of a conserved gene causing a main pathogen of porcine digestive tract virus diseases; a quadruple fluorescent quantitative PCR detection method is established for detecting porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TEGV), porcine delta coronavirus (PDCoV) and porcine intestinal alpha coronavirus (PEAV); a most direct basis is provided for timely treatment, prevention and control of epidemic situations, and the sound development of the pig industry is escorted.

Description

technical field [0001] The invention relates to a veterinary detection kit and a method for using the detection kit in non-disease detection. Specifically, the invention is a 4-fold fluorescence quantitative PCR for porcine enteric coronavirus and a corresponding method for use. The above-mentioned 4-fold porcine viral diarrhea virus refers to: porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine delta coronavirus and porcine intestinal alpha coronavirus. Background technique [0002] Porcine viral diarrhea is one of the important infectious diseases that seriously harm the pig industry. The main traditional pathogens causing porcine viral diarrhea are porcine epidemic diarrhea virus (PEDV) and porcine transmissible gastroenteritis virus (TGEV). In recent years, porcine deltacoronavirus (PDCoV) and porcine enteric alphacoronavirus (PEAV) have been newly discovered, and these two coronaviruses are also seriously harmful to piglets. These viru...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851
CPCC12Q1/6851C12Q1/701C12Q2600/16C12Q2531/113C12Q2563/107C12Q2537/143Y02A50/30
Inventor 刘光亮陈佳宁黄鑫
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI