Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

39 results about "Porcine deltacoronavirus" patented technology

Method for simultaneously detecting multiple RT-PCR of GETV, PEDV, TGEV, PDCoV and PoRV

The invention discloses a multiple RT-PCR primer group for simultaneously detecting porcine gatahvirus (GETV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV) and porcine A rotaviruses (PoRV), which has a nucleotide sequence as shown in SEQ ID NO:1-SEQ ID NO:10. The invention further discloses a multiple RT-PCR detection method for detecting GETV, PEDV, TGEV, PDCoV and PoRV from a sample in one time by utilizing the multiple RT-PCR primer group. Compared with an existing conventional RT-PCR, the detection method has strong specificity and high sensitivity, can realizesimultaneous identification of five viruses including GETV, PEDV, TGEV, PDCoV and PoRV, and has accurate detection result and high detection efficiency.
Owner:HENAN AGRICULTURAL UNIVERSITY

Preparation method of porcine deltacoronavirus recombinant N protein and preparation method of polyclonal antibody of porcine deltacoronavirus recombinant N protein

The invention discloses a preparation method of a porcine deltacoronavirus (PDCoV) recombinant N protein. The method comprises the steps that the N gene segment of the PDoV is amplified, subjected toprokaryotic expression and purified in sequence, and the recombinant N protein is obtained. On this basis, the invention further provides a preparation method of a polyclonal antibody of the recombinant N protein. The method comprises the steps that the PDoV recombinant N protein and the Freund's adjuvant are emulsified to immunize animals to obtain polyclonal antibody serum. Through experiments,it is shown that the N gene of the PDCoV is successfully amplified, and the amplified N gene is subjected to prokaryotic expression and purified, the immunogenicity of the recombinant N protein is primarily studied, and a basis is laid for developing a diagnostic kit or preparing the polyclonal antibody.
Owner:GUANGXI VETERINARY RES INST

Novel Vaccine Compositions for Porcine Epidemic Diarrhea Virus and Porcine Deltacoronavirus

ActiveUS20170202951A1Elicit production of neutralizing antibodies in swineEfficient productionSsRNA viruses positive-senseViral antigen ingredientsDiseaseAdjuvant
The present invention is directed to novel immunogenic compositions that protect swine from disease caused by porcine epidemic diarrhea virus (PEDV). The present invention is also directed to novel immunogenic compositions that protect swine from disease caused by porcine deltacoronavirus (PDCoV), alone or as combination vaccine to protect against PEDV. The compositions of the invention provide killed viruses whose effectiveness is enhanced by the selection of preferred adjuvants. Novel culture methods are also employed to increase reproducible yield of cultured viruses. Live vaccines are also provided from the Calaf14 PEDV isolate.
Owner:ZOETIS SERVICE LLC

Primer combination used for rapid isothermal detection of porcine deltacoronavirus, and method thereof

The invention discloses a primer combination used for rapid isothermal detection of porcine deltacoronavirus, and a method thereof. The method using a loop-mediated isothermal amplification (LAMP) technology to detect the porcine deltacoronavirus, disclosed in the invention, is used to detect the porcine deltacoronavirus in an environment sample, a medical sample and the sanitation and epidemic prevention field. The method comprises the following steps: designing specific primers by adopting an N segment encoding region gene sequence in a porcine deltacoronavirus genome as a target sequence, optimizing a reaction system, and carrying out target gene specific amplification. The method only needs a constant temperature device, does not need thermotropy and long-time temperature circulation of a template, allows a result to be directly observed, and has the characteristics of low cost, high efficiency and simple operation. The porcine deltacoronaviru nucleic acid LAMP detection method established in the invention also has the characteristics of strong specificity, high sensitivity, high convenience and fastness, can be implemented in a base laboratory and a miniature experiment station, and provides a new technology and method for detection of the porcine deltacoronaviru.
Owner:ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Porcine epizootic diarrhea, transmissible gastroenteritis and porcine deltacoronavirus triple subunit vaccine

The invention provides a porcine epizootic diarrhea, transmissible gastroenteritis and porcine deltacoronavirus triple subunit vaccine, which consists of an antigen and a vaccine adjuvant, wherein theantigen includes porcine epizootic diarrhea virus S1 protein which is expressed by an X33-PEDV-S1 strain that preservation number of CGMCC No.14372, transmissible gastroenteritis virus S1 protein which is expressed by an X33-TGEV-S1 strain that preservation number is CGMCC No.14371 and porcine deltacoronavirus S1 protein which is expressed by an X33-PDCoV-S1 strain that preservation number is CGMCC No.14370. The porcine epizootic diarrhea, transmissible gastroenteritis and porcine deltacoronavirus triple subunit vaccine provided by the invention is high in safety and good in immunogenicity, and the triple vaccine, after being applied to immunization, can rapidly generate an antibody and can keep antibody titer at a relatively high level for a long time; the vaccine is long in preservationperiod and low in immunizing dose; the adopted adjuvant is easy to inject; and three major diarrhea-related viral diseases can be prevented and treated by conducting injection once, so that the survival rate of piglets is improved.
Owner:陕西诺威利华生物科技有限公司

Separation of porcine deltacoronavirus strain, preparation and application of inactivated vaccine

The invention belongs to the technical field of animal virology and epizootiology, particularly relates to separation of a porcine deltacoronavirus strain, preparation and application of an inactivated vaccine, and discloses a separating cultivation method of the porcine deltacoronavirus strain, preparation and application of the inactivated vaccine. According to the invention, the separated porcine deltacoronavirus CHN-HN-2014 strain is preserved in China Center for Type Culture Collection with the preservation number of CCTCC NO: V201650. The preserved inactivated vaccine prepared by porcinedeltacoronavirus has good immunogenicity, can induce piglets to generate neutralizing antibody with higher level, and can effectively protect immunized piglets from attack of the porcine deltacoronavirus.
Owner:HUAZHONG AGRI UNIV

Pig porcine deltacoronavirus N protein indirect ELISA antibody detection method and kit thereof

The invention discloses a pig porcine deltacoronavirus N protein indirect ELISA antibody detection kit. The pig porcine deltacoronavirus N protein indirect ELISA antibody detection kit comprises a coated ELISA plate, and the coated ELISA plate takes recombinant N protein as a coated antigen. According to the detection kit, a corresponding ELISA detection method is further built and a diagnosis tool with practical value is provided for PECoV detection. By the adoption of the pig porcine deltacoronavirus N protein indirect ELISA antibody kit, the method for identifying the antibody generated byinfection of pig porcine deltacoronavirus is built, has high specificity and sensitivity, and is easy to operate, short in consumed time and low in cost; detection can be conducted in large batch, andthe detection kit and method have great significance on prevention and purification of pig porcine deltacoronavirus.
Owner:GUANGXI VETERINARY RES INST

Porcine deltacoronavirus strain and application thereof

The invention provides a porcine deltacoronavirus strain and application thereof, and belongs to the technical field of immunoprophylaxis of pigs. The porcine deltacoronavirus strain is deposited in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 17383. The porcine deltacoronavirus strain is highly toxic. When the porcine deltacoronavirus strain is inactivated to prepare a porcine epidemic diarrhea virus, the immune effect is good.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

TaqMan fluorogenic quantitative PCR kit and detection method for porcine deltacoronavirus

The invention discloses a TaqMan fluorogenic quantitative PCR kit and a detection method for porcine deltacoronavirus. The kit comprises specific primers and a probe, wherein primer sequences are as follow: the upstream primer is 5'-ACGTCGTAAGACCCAGCATC-3' and the downstream primer is 5'-CCCACCTGAAAGTTGCTCTC-3', and a probe sequence is 5'-FAM-GTATGGCTGATCCTCGCATCATGGC-BHQ1-3'. A gene part fragment648bp of the porcine deltacoronavirus is expanded, a lowest detection limit of the TaqMan real-time fluorogenic quantitative PCR disclosed by the invention is 26.6copies / mu L, and the detection results of the TaqMan real-time fluorogenic quantitative PCR to swine transmissible gastroenteritis virus, porcine epidemic diarrhea virus, porcine kobuvirus, porcine reproductive and respiratory syndromevirus as well as foot and mouth disease virus are all feminine. The TaqMan probe real-time fluorogenic quantitative PCR method for detecting the porcine deltacoronavirus (PDCoV) disclosed by the invention has the advantages of strong specificity, high sensitivity and good inter-batch and intra-batch repeatability. When the TaqMan probe real-time fluorogenic quantitative PCR method disclosed by theinvention are used for detecting 194 clinical pig manure samples, a result shows that a PDCoV positive rate is 22.1% and is about one time higher than a 11.9% positive rate of detecting the clinicalpig manure samples by general RT-PCR.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Porcine Deltacoronavirus and swine transmissible gastroenteritis virus multiplex RT-PCR detection primer and detection method

The invention discloses a porcine Deltacoronavirus (PDCoV) and swine transmissible gastroenteritis virus (TGEV) multiplex RT-PCR detection primer. The primer sequence of PDCoV is expressed as follows: upstream primer P1: 5'-ATGGCTACTGGCTGCGTTAC-3', downstream primer P2: 5'-GCGTTTCCTGGGCTGATT-3', and partial PDCoV gene segments are amplified by 383 bp. The primer sequence of TGEV is expressed as follows: upstream primer P3: 5'-CCCTCCAGCAAGGTTCAA-3', downstream primer P4: 5'-GCAACCCAGACAACTCCA-3', and partial TGEV gene segments are amplified by 229 bp. The detection limits of multiplex RT-PCR on PDCoV and TGEV are 4.05*101 copy per microliter and 5.47*102 copy per microliter respectively, and amplified results on porcine epidemic diarrhea virus, bocavirus, porcine reproductive and respiratory syndrome virus and porcine rotavirus are negative. Multiplex RT-PCR detection results of 57 clinical samples show that the positive rate of being infected with the two viruses at the same time is 1.75%, the PDCoV infection positive rate is 19.30%, and the TGEV infection positive rate is 1.75%.
Owner:HENAN AGRICULTURAL UNIVERSITY

Double-antibody sandwich ELISA antigen detection kit for Porcine deltacoronavirus (PDCoV) N protein

The invention belongs to the field of biotechnology detection and particularly relates to a double-antibody sandwich ELISA antigen detection kit for Porcine deltacoronavirus (PDCoV) N protein. The kitcomprises a monoclonal antibody PDCoV-N-1A2 ELISA plate, positive and negative controls, an HRP labeled detection antibody PDCoV-N-5C5, a sample diluent, a color developing solution and a washing solution, wherein the antibodies PDCoV-N-1A2 and PDCoV-N-5C5 are secreted by hybridoma cell strains PDCoV-N-1A2 and PDCoV-N-1A2, respectively. The kit of the invention can specifically detect PDCoV N protein by the double-antibody sandwich ELSIA method established by using 1A2 as a capture antibody and using hybridization 5C5 (HRP coupled) as a detection antibody, and provides a new detection means for the clinical diagnosis and epidemiological investigation of PDCoV infection.
Owner:YANGZHOU UNIV

Universal type porcine deltacoronavirus nested RT-PCR detection method

PendingCN109536642AIntegrity guaranteedOvercome the problems of low detection sensitivity and poor specificityMicrobiological testing/measurementMicroorganism based processesPositive controlBiology
The present invention provides nested RT-PCR primers, a detection method and a kit used for detecting porcine deltacoronavirus. The nested RT-PCR primers are two pairs of designed primers according toa highly conserved specific sequence of the porcine deltacoronavirus. The detection method comprises the following steps: sample RNA is extracted; the obtained sample RNA is used as a template, and the primers are used to conduct an RT-PCR reaction; and a reaction product is subjected to an agarose gel electrophoresis analysis. The kit comprises the primers, an amplification reagent, a positive control and a negative control. A provided technical scheme is strong in specificity, high in sensitivity, good in an anti-interference performance and also strong in reliability, overcomes problems oflow sensitivity, poor specificity, etc. of common detection methods, and is relatively low in costs, short in detection cycles and strong in practicability compared with existing detection methods ofnucleic acid hybridization, gene chips, etc.
Owner:YANGTZE UNIVERSITY

Porcine deltacoronavirus strain

The invention discloses a porcine deltacoronavirus strain, which is assigned with the accession number of CCTCC NO:V201558. According to the obtained porcine deltacoronavirus strain, an important foundation is to be laid for the etiology investigation, epidemiological investigation, diagnosis prevention and control and vaccine research of the virus.
Owner:HENAN AGRICULTURAL UNIVERSITY

Multiplex PCR (Polymerase Chain Reaction) detection primer group and kit for fast distinguishing porcine deltacoronavirus from porcine kobuvirus

The invention discloses a multiplex PCR (Polymerase Chain Reaction) detection primer group and a kit for fast distinguishing porcine deltacoronavirus from porcine kobuvirus. According to PDCoV and PKoV sequences collected in GenBank, differences between PDCoV and PKoV are compared; specific primers L1, L2, L3 and L4 are automatically designed; the primer group can perform specific amplification onPDCoV and PKoV, wherein the primers L1 and L2 ca be used for amplifying PKoV; the primers L3 and L4 can be used for amplifying PDCoV. The inventor successfully invents a special kit on the basis. Virus RNA is firstly extracted; an RT-PCR (Reverse Transcriptase-Polymerase Chain Reaction) method is used for identifying and detecting the PDCoV and PKoV; the size of the PKoV expected amplification fragments is 743bp; the size of the PDCoV expected amplification fragments is 1017bp. Compared with the prior art, the special kit has the advantages of high sensitivity, high specificity and good repeatability, and can be widely applied to clinic PDCoV and PKoV detection.
Owner:INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE HENAN ACAD OF AGRI SCI

Porcine deltacoronavirus and application thereof

The invention provides a porcine deltacoronavirus and application thereof. The porcine deltacoronavirus is isolated from pig intestinal tissues, and a porcine deltacoronavirus PDC-SX19 is obtained bypassage and purification, with a preservation number of CGMCC No. 18332. The isolate can realize stable proliferation on the passage cells and produce typical cytopathy. The porcine deltacoronavirus isolate of the invention has an excellent immunogenicity; a vaccine prepared by the isolate can induce piglets to produce a high-level neutralizing antibody; and an ELISA kit prepared by the isolate can better detect the porcine deltacoronavirus antibody in serum.
Owner:CHINA ANIMAL HUSBANDRY IND

Porcine coronavirus vaccines

The present invention relates to a vaccine for protecting a pig against diseases associated with corona virus infection including porcine epidemic diarrhea virus (PEDV) and / or porcine deltacorona virus (PDCoV). The vaccine commonly includes inactivated / killed PEDV (e.g., chemically inactivated PED virus), and / or recombinant PEDV antigen, and / or an adjuvant inactivated / killed PDCoV (e.g., chemically inactivated PDCoV virus), and / or recombinant PDCoV antigen and an adjuvant. Methods for protecting pigs against diseases associated with PEDV and / or PDCoV and methods of producing the porcine epidemic diarrhea virus and / or porcine deltacorona virus vaccine are also provided.
Owner:BOEHRINGER INGELHEIM ANIMAL HEALTH USA INC

Porcine deltacoronavirus LFD-RPA rapid detection primer probe set and kit

The invention relates to a porcine deltacoronavirus LFD-RPA rapid detection primer probe set and a kit, and belongs to the field of biotechnology. The primer probe set includes an upstream primer, a downstream primer and a probe; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, the downstream primer is a substance of which the nucleotide sequence is shown in SEQ ID NO.2 and the 5' end is modified by biotin, and the probe is a substance of which the nucleotide sequence is shown in SEQ ID NO.3, the 5' end is modified by C3Spacer, the 5' end is modified with fluorescein and the thirtieth base from the 5' end is modified by a tetrahydrofuran residue. By adopting the porcine deltacoronavirus LFD-RPA rapid detection primer probe set, porcine deltacoronaviruses can be rapidly detected; the primer probe set is simple and high in sensitivity and specificity and can improve the effectiveness of a current PDCoV controlling scheme.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Multiple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group and kit for rapidly distinguishing PEDV (porcine epidemic diarrhea virus), PDCoV (porcine deltacoronavirus) and PReoV (porcine reovirus)

The invention discloses a multiple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group and kit for rapidly distinguishing PEDV (porcine epidemic diarrhea virus), PDCoV (porcine deltacoronavirus) and PReoV (porcine reovirus), and belongs to the technical field of animal virology and molecular biology. The kit comprises primer sequences as shown in SEQ ID 1-6, Prime STARHR buffer solution, a cDNA template and sterile water. The multiple RT-PCR detection kit of the PEDV, the PDCoV and the PReoV is amplified by multiple RT-PCR, three lesions are similar and serve as primary detection of RNA viruses, total detection time is controlled to be about 2 hours, the detection method is easy to operate, convenient and rapid, and rapid detection can be achieved.
Owner:GUANGXI VETERINARY RES INST

Vaccine compositions for porcine epidemic diarrhea virus and porcine deltacoronavirus

ActiveUS10251950B2Elicit production of neutralizing antibodies in swineEfficient productionSsRNA viruses positive-senseViral antigen ingredientsDiseaseAdjuvant
The present invention is directed to novel immunogenic compositions that protect swine from disease caused by porcine epidemic diarrhea virus (PEDV). The present invention is also directed to novel immunogenic compositions that protect swine from disease caused by porcine deltacoronavirus (PDCoV), alone or as combination vaccine to protect against PEDV. The compositions of the invention provide killed viruses whose effectiveness is enhanced by the selection of preferred adjuvants. Novel culture methods are also employed to increase reproducible yield of cultured viruses. Live vaccines are also provided from the Calaf14 PEDV isolate.
Owner:ZOETIS SERVICE LLC

Bivalent attenuated vaccine for porcine epidemic diarrhea and porcine delta coronavirus and a preparation method thereof

The invention provides a bivalent attenuated vaccine for porcine epidemic diarrhea and porcine deltacoronavirus and a preparation method thereof. By adopting a cell continuous passage method and a cell suspension culture technology, the invention provides the bivalent attenuated vaccine which is high in immune protection rate, good in stability, high in yield, safe and reliable and is used for emergency prevention of inoculated porcine epidemic diarrhea and porcine deltacoronavirus, and an effective means is provided for prevention and control of PEDV and PDCoV.
Owner:WUHAN KEQIAN BIOLOGY CO LTD

Method for efficiently separating pig intestinal tract coronavirus

The invention belongs to the technical field of animal virology, and particularly relates to a method for efficiently separating pig intestinal tract coronavirus. The pig intestinal tract coronavirusis prepared from PEDV (Porcine Epidemic Diarrhea Virus), PDCoV(Porcine Deltacoronavirus) and TGEV (Transmissible Gastroenteritis Virus). According to the method, differential centrifugation is adoptedto remove impurities, PEG(polyethylene glycol) 6000 is used for precipitating and concentrating viruses, impurity contents in a virus sample can be lowered to a maximum degree through the steps of purification of virus by the sucrose gradient centrifugation, and viruses are concentrated. The virus sample prepared with the method is especially suitable for inoculating cells and separating viruses.Compared with the virus sample prepared in the prior art, the method is characterized in that cell toxicity is greatly reduced, a virus separation rate is obviously improved, and the separation rateis improved to be above 40% from 10% of a traditional method.
Owner:HUAZHONG AGRI UNIV

Primer and probe for detecting porcine deltacoronavirus, fluorescent quantitative PCR kit as well as method and application

The invention discloses a primer and a probe for detecting porcine deltacoronavirus, a fluorescent quantitative PCR kit as well as a method and application, wherein a nucleotide sequence of the primeris as follows: an upstream primer: 5'CGCTTAACTCCGCCATCAA 3', and a downstream primer: 5'TGGTGTAACGCAGCCAATAGC 3'; the sequence of the probe is as follows: 5'FAM-CCCGTTGAAAACC-MGB 3'. The invention has the benefits that the detection of the porcine deltacoronavirus can be achieved quickly and accurately by using the kit provided by the invention; the kit provided by the invention has good linear relation in the template range of 3.15*10<1>-3.15*10<8>copies*[mu]L<-1>, and the sensitivity is 100 times that of a conventional PCR; the kit is good in specificity, and has no cross-reactivity with other porcine viruses; a reproducibility test coefficient of variation is less than 1.3%; compared with the conventional PCR method, the method has a higher positive detection rate for clinical samples;in summary, the method is strong in specificity, high in sensitivity and good in reproducibility, and provides a rapid and accurate detection method for laboratory diagnosis and epidemiological investigation of the porcine deltacoronavirus.
Owner:SHANDONG NEW HOPE LIUHE GROUP

Primer combination for TGEV, PEDV and PDCoV triple PCR detection, kit and and application of primer combination and kit

The invention relates to the field of biological medicine, in particular to a primer combination for TGEV, PEDV and PDCoV triple PCR detection, a kit and application of the primer combination and the kit. According to the invention, porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine deltacoronavirus are taken as detection objects, and a triple PCR detection method is established. Software such as Snapgene, DNAMAN, Primer5 and the like is utilized to find a segment with relatively high homology of the three to design a degenerate primer, and the method has important practical significance and clinical application value.
Owner:广州博达锦弘生物科技有限公司

Quadruple RT-PCR detection primers and kits for four porcine diarrhea viruses

The invention relates to quadruple RT-PCR detection primers and kits for porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine group A rotavirus and porcine deltacoronavirus, belonging to the technical field of molecular detection. The quadruple RT-PCR detection primers of the present invention include porcine epidemic diarrhea virus detection primers PEDV F and PEDV R; porcine transmissible gastroenteritis virus detection primers TGEV F and TGEV R; porcine group A rotavirus detection primers PoRV F and PoRV R; and porcine deltacoronavirus detection primers PDCoV‑F and PDCoV‑R. The primer of the invention has strong specificity, repeatability, high sensitivity and high clinical reliability.
Owner:ANHUI AGRICULTURAL UNIVERSITY

A porcine deltacoronavirus strain

The invention discloses a porcine deltacoronavirus strain (Porcine Deltacoronavirus), CCTCC NO: V201558. The invention obtains a porcine delta coronavirus strain, which will lay an important foundation for the pathogenic research, epidemiological investigation, diagnosis and control and vaccine research of the virus.
Owner:HENAN AGRICULTURAL UNIVERSITY

Porcine delta coronavirus n protein monoclonal antibody and its antigenic epitope and application

ActiveCN109796531BRapid and Accurate Differential DiagnosisImmunoglobulins against virusesMicroorganism based processesEpitopeProtein.monoclonal
The invention discloses a porcine Delta coronavirus N protein monoclonal antibody secreted by a hybridoma cell line with a preservation number of CCTCC NO: C2017257. The invention also discloses a kit for detecting porcine Delta coronavirus comprising the monoclonal antibody. The present invention also discloses an antigenic epitope of porcine Delta coronavirus N protein, the amino acid sequence of which is shown in SEQ ID NO.15. The porcine Delta coronavirus N protein monoclonal antibody of the invention can specifically recognize the N protein of PDCoV, and can be used for rapid and sensitive detection and diagnosis of porcine Delta coronavirus.
Owner:SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI

Pig viral diarrhea detection primer combination, detection kit and application

The invention discloses a porcine viral diarrhea detection primer combination, a detection kit and application, and relates to the technical field of porcine viral diarrhea detection. The kit comprises a first probe primer pair, a second probe primer pair, a third probe primer pair and a fourth probe primer pair. The detection primer combination and the detection kit can be used for detecting and analyzing porcine epidemic diarrhea, porcine transmissible gastroenteritis, porcine rotavirus and porcine deltacoronavirus in a sample at one time, so that the amplification efficiency of four virus genes is consistent, and the sensitivity of the four virus genes is consistent with that of each single reaction; the method has the characteristics of simplicity, convenience, rapidness, good stability, high detection sensitivity and strong specificity. The detection kit provided by the invention has the advantages of convenience in detection, high accuracy and high detection efficiency, can be applied to daily detection work in pig farms, and provides technical support for clinical diagnosis of four viruses with similar clinical manifestation for porcine viral diarrhea.
Owner:山东傲农种猪有限公司 +5

Quintuple RT-PCR detection method for the pathogen of porcine viral diarrhea

This application discloses a five-fold RT-PCR detection method for the pathogen of porcine viral diarrhea disease, in which the five pairs of primers are the detection primers of porcine delta coronavirus (also known as porcine D-coronavirus) and the detection primers of porcine protuberance virus , Porcine epidemic diarrhea virus detection primers, porcine acute diarrhea syndrome coronavirus detection primers, transmissible gastroenteritis virus detection primers. Using the nucleic acid or reverse transcription product of the sample to be tested as a template, use 2×Taq Plus Master Mix to perform PCR amplification using 5 pairs of primers in this application. The patent allows simultaneous detection of up to five viruses that can cause diarrhea in pigs in one PCR reaction tube, and its detection sensitivity reaches an initial template concentration of 1×10 per microliter 3 copies (1×10 3 copies / μL), and has excellent specificity and repeatability, and can be directly applied to the detection of clinical samples.
Owner:华派生物技术(集团)股份有限公司

A strain of porcine deltacoronavirus and its application

The invention provides a strain of porcine deltacoronavirus (Porcine deltacoronavirus) and application thereof. The invention separates from pig intestinal tissue, and obtains a strain of porcine delta coronavirus PDC‑SX19 through subculture and purification, and its microorganism preservation number is CGMCC No.18332. The isolated strain can proliferate stably on passaged cells and produce typical cytopathic changes. The porcine deltacoronavirus isolate of the present invention has excellent immunogenicity; the vaccine prepared by using the isolate can induce piglets to produce high levels of neutralizing antibodies; meanwhile, the ELISA kit prepared by using the isolate can better detect serum Antibodies against porcine deltacoronavirus.
Owner:CHINA ANIMAL HUSBANDRY IND

A method for efficiently isolating porcine enteric coronavirus

The invention belongs to the technical field of animal virology. Specifically relates to a method for efficiently isolating porcine enteric coronavirus. The porcine enteric coronavirus includes porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV) and porcine transmissible gastroenteritis virus (TGEV). The present invention adopts steps such as differential centrifugation to remove impurities, using polyethylene glycol (PEG) 6000 to precipitate and concentrate viruses, and then purifying viruses through sucrose gradient centrifugation, thereby minimizing the impurity content in virus samples and concentrating viruses. The virus sample prepared by the invention is especially suitable for inoculating cells and isolating viruses. Compared with the virus samples prepared by the prior art, the toxicity to cells is greatly reduced, and the virus isolation rate is significantly improved, and the isolation rate can be increased from about 10% in the traditional method to more than 40%.
Owner:HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More