Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

39 results about "Porcine deltacoronavirus" patented technology

Primer combination used for rapid isothermal detection of porcine deltacoronavirus, and method thereof

The invention discloses a primer combination used for rapid isothermal detection of porcine deltacoronavirus, and a method thereof. The method using a loop-mediated isothermal amplification (LAMP) technology to detect the porcine deltacoronavirus, disclosed in the invention, is used to detect the porcine deltacoronavirus in an environment sample, a medical sample and the sanitation and epidemic prevention field. The method comprises the following steps: designing specific primers by adopting an N segment encoding region gene sequence in a porcine deltacoronavirus genome as a target sequence, optimizing a reaction system, and carrying out target gene specific amplification. The method only needs a constant temperature device, does not need thermotropy and long-time temperature circulation of a template, allows a result to be directly observed, and has the characteristics of low cost, high efficiency and simple operation. The porcine deltacoronaviru nucleic acid LAMP detection method established in the invention also has the characteristics of strong specificity, high sensitivity, high convenience and fastness, can be implemented in a base laboratory and a miniature experiment station, and provides a new technology and method for detection of the porcine deltacoronaviru.
Owner:ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Porcine epizootic diarrhea, transmissible gastroenteritis and porcine deltacoronavirus triple subunit vaccine

The invention provides a porcine epizootic diarrhea, transmissible gastroenteritis and porcine deltacoronavirus triple subunit vaccine, which consists of an antigen and a vaccine adjuvant, wherein theantigen includes porcine epizootic diarrhea virus S1 protein which is expressed by an X33-PEDV-S1 strain that preservation number of CGMCC No.14372, transmissible gastroenteritis virus S1 protein which is expressed by an X33-TGEV-S1 strain that preservation number is CGMCC No.14371 and porcine deltacoronavirus S1 protein which is expressed by an X33-PDCoV-S1 strain that preservation number is CGMCC No.14370. The porcine epizootic diarrhea, transmissible gastroenteritis and porcine deltacoronavirus triple subunit vaccine provided by the invention is high in safety and good in immunogenicity, and the triple vaccine, after being applied to immunization, can rapidly generate an antibody and can keep antibody titer at a relatively high level for a long time; the vaccine is long in preservationperiod and low in immunizing dose; the adopted adjuvant is easy to inject; and three major diarrhea-related viral diseases can be prevented and treated by conducting injection once, so that the survival rate of piglets is improved.
Owner:陕西诺威利华生物科技有限公司

Porcine deltacoronavirus strain and application thereof

The invention provides a porcine deltacoronavirus strain and application thereof, and belongs to the technical field of immunoprophylaxis of pigs. The porcine deltacoronavirus strain is deposited in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 17383. The porcine deltacoronavirus strain is highly toxic. When the porcine deltacoronavirus strain is inactivated to prepare a porcine epidemic diarrhea virus, the immune effect is good.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

TaqMan fluorogenic quantitative PCR kit and detection method for porcine deltacoronavirus

The invention discloses a TaqMan fluorogenic quantitative PCR kit and a detection method for porcine deltacoronavirus. The kit comprises specific primers and a probe, wherein primer sequences are as follow: the upstream primer is 5'-ACGTCGTAAGACCCAGCATC-3' and the downstream primer is 5'-CCCACCTGAAAGTTGCTCTC-3', and a probe sequence is 5'-FAM-GTATGGCTGATCCTCGCATCATGGC-BHQ1-3'. A gene part fragment648bp of the porcine deltacoronavirus is expanded, a lowest detection limit of the TaqMan real-time fluorogenic quantitative PCR disclosed by the invention is 26.6copies/mu L, and the detection results of the TaqMan real-time fluorogenic quantitative PCR to swine transmissible gastroenteritis virus, porcine epidemic diarrhea virus, porcine kobuvirus, porcine reproductive and respiratory syndromevirus as well as foot and mouth disease virus are all feminine. The TaqMan probe real-time fluorogenic quantitative PCR method for detecting the porcine deltacoronavirus (PDCoV) disclosed by the invention has the advantages of strong specificity, high sensitivity and good inter-batch and intra-batch repeatability. When the TaqMan probe real-time fluorogenic quantitative PCR method disclosed by theinvention are used for detecting 194 clinical pig manure samples, a result shows that a PDCoV positive rate is 22.1% and is about one time higher than a 11.9% positive rate of detecting the clinicalpig manure samples by general RT-PCR.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Porcine Deltacoronavirus and swine transmissible gastroenteritis virus multiplex RT-PCR detection primer and detection method

The invention discloses a porcine Deltacoronavirus (PDCoV) and swine transmissible gastroenteritis virus (TGEV) multiplex RT-PCR detection primer. The primer sequence of PDCoV is expressed as follows: upstream primer P1: 5'-ATGGCTACTGGCTGCGTTAC-3', downstream primer P2: 5'-GCGTTTCCTGGGCTGATT-3', and partial PDCoV gene segments are amplified by 383 bp. The primer sequence of TGEV is expressed as follows: upstream primer P3: 5'-CCCTCCAGCAAGGTTCAA-3', downstream primer P4: 5'-GCAACCCAGACAACTCCA-3', and partial TGEV gene segments are amplified by 229 bp. The detection limits of multiplex RT-PCR on PDCoV and TGEV are 4.05*101 copy per microliter and 5.47*102 copy per microliter respectively, and amplified results on porcine epidemic diarrhea virus, bocavirus, porcine reproductive and respiratory syndrome virus and porcine rotavirus are negative. Multiplex RT-PCR detection results of 57 clinical samples show that the positive rate of being infected with the two viruses at the same time is 1.75%, the PDCoV infection positive rate is 19.30%, and the TGEV infection positive rate is 1.75%.
Owner:HENAN AGRICULTURAL UNIVERSITY

Universal type porcine deltacoronavirus nested RT-PCR detection method

PendingCN109536642AIntegrity guaranteedOvercome the problems of low detection sensitivity and poor specificityMicrobiological testing/measurementMicroorganism based processesPositive controlBiology
The present invention provides nested RT-PCR primers, a detection method and a kit used for detecting porcine deltacoronavirus. The nested RT-PCR primers are two pairs of designed primers according toa highly conserved specific sequence of the porcine deltacoronavirus. The detection method comprises the following steps: sample RNA is extracted; the obtained sample RNA is used as a template, and the primers are used to conduct an RT-PCR reaction; and a reaction product is subjected to an agarose gel electrophoresis analysis. The kit comprises the primers, an amplification reagent, a positive control and a negative control. A provided technical scheme is strong in specificity, high in sensitivity, good in an anti-interference performance and also strong in reliability, overcomes problems oflow sensitivity, poor specificity, etc. of common detection methods, and is relatively low in costs, short in detection cycles and strong in practicability compared with existing detection methods ofnucleic acid hybridization, gene chips, etc.
Owner:YANGTZE UNIVERSITY

Porcine deltacoronavirus strain

The invention discloses a porcine deltacoronavirus strain, which is assigned with the accession number of CCTCC NO:V201558. According to the obtained porcine deltacoronavirus strain, an important foundation is to be laid for the etiology investigation, epidemiological investigation, diagnosis prevention and control and vaccine research of the virus.
Owner:HENAN AGRICULTURAL UNIVERSITY

Porcine deltacoronavirus LFD-RPA rapid detection primer probe set and kit

The invention relates to a porcine deltacoronavirus LFD-RPA rapid detection primer probe set and a kit, and belongs to the field of biotechnology. The primer probe set includes an upstream primer, a downstream primer and a probe; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, the downstream primer is a substance of which the nucleotide sequence is shown in SEQ ID NO.2 and the 5' end is modified by biotin, and the probe is a substance of which the nucleotide sequence is shown in SEQ ID NO.3, the 5' end is modified by C3Spacer, the 5' end is modified with fluorescein and the thirtieth base from the 5' end is modified by a tetrahydrofuran residue. By adopting the porcine deltacoronavirus LFD-RPA rapid detection primer probe set, porcine deltacoronaviruses can be rapidly detected; the primer probe set is simple and high in sensitivity and specificity and can improve the effectiveness of a current PDCoV controlling scheme.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Multiple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group and kit for rapidly distinguishing PEDV (porcine epidemic diarrhea virus), PDCoV (porcine deltacoronavirus) and PReoV (porcine reovirus)

The invention discloses a multiple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group and kit for rapidly distinguishing PEDV (porcine epidemic diarrhea virus), PDCoV (porcine deltacoronavirus) and PReoV (porcine reovirus), and belongs to the technical field of animal virology and molecular biology. The kit comprises primer sequences as shown in SEQ ID 1-6, Prime STARHR buffer solution, a cDNA template and sterile water. The multiple RT-PCR detection kit of the PEDV, the PDCoV and the PReoV is amplified by multiple RT-PCR, three lesions are similar and serve as primary detection of RNA viruses, total detection time is controlled to be about 2 hours, the detection method is easy to operate, convenient and rapid, and rapid detection can be achieved.
Owner:GUANGXI VETERINARY RES INST

Primer and probe for detecting porcine deltacoronavirus, fluorescent quantitative PCR kit as well as method and application

The invention discloses a primer and a probe for detecting porcine deltacoronavirus, a fluorescent quantitative PCR kit as well as a method and application, wherein a nucleotide sequence of the primeris as follows: an upstream primer: 5'CGCTTAACTCCGCCATCAA 3', and a downstream primer: 5'TGGTGTAACGCAGCCAATAGC 3'; the sequence of the probe is as follows: 5'FAM-CCCGTTGAAAACC-MGB 3'. The invention has the benefits that the detection of the porcine deltacoronavirus can be achieved quickly and accurately by using the kit provided by the invention; the kit provided by the invention has good linear relation in the template range of 3.15*10<1>-3.15*10<8>copies*[mu]L<-1>, and the sensitivity is 100 times that of a conventional PCR; the kit is good in specificity, and has no cross-reactivity with other porcine viruses; a reproducibility test coefficient of variation is less than 1.3%; compared with the conventional PCR method, the method has a higher positive detection rate for clinical samples;in summary, the method is strong in specificity, high in sensitivity and good in reproducibility, and provides a rapid and accurate detection method for laboratory diagnosis and epidemiological investigation of the porcine deltacoronavirus.
Owner:SHANDONG NEW HOPE LIUHE GROUP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products