Primer and probe for detecting porcine deltacoronavirus, fluorescent quantitative PCR kit as well as method and application

A coronavirus and fluorescence quantitative technology, applied in the field of virus PCR detection, can solve the problems of long detection time, insufficient specificity and sensitivity, cumbersome operation, etc., and achieve high sensitivity, strong specificity and good repeatability

Inactive Publication Date: 2018-11-20
SHANDONG NEW HOPE LIUHE GROUP
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These conventional methods are cumbersome to operate and take a long time to detect, some need 5-7 days or even longer to produce results
In addition, these conventional methods have insufficient specificity and sensitivity when used for PDCoV detection, especially when the virus content is low in the early stage of virus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe for detecting porcine deltacoronavirus, fluorescent quantitative PCR kit as well as method and application
  • Primer and probe for detecting porcine deltacoronavirus, fluorescent quantitative PCR kit as well as method and application
  • Primer and probe for detecting porcine deltacoronavirus, fluorescent quantitative PCR kit as well as method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Primers and Probes

[0046] The embodiment of the present invention provides a primer and probe for specific detection of PDCoV, wherein:

[0047] The primer sequences are as follows:

[0048] Upstream primer: 5' CGCTTAACTCCGCCATCAA 3',

[0049] Downstream primer: 5' TGGTGTAACGCAGCCAATAGC 3';

[0050] The probe sequence is as follows:

[0051] 5' FAM-CCCGTTGAAAACC-MGB 3'.

Embodiment 2

[0052] Example 2 Fluorescent quantitative PCR detection reagent

[0053] An embodiment of the present invention provides a fluorescent quantitative PCR detection reagent for detecting PDCoV, which includes the following components: reaction mixture, water, and primers and probes for detecting PDCoV; wherein,

[0054] The primer sequences are as follows:

[0055] Upstream primer: 5' CGCTTAACTCCGCCATCAA 3',

[0056] Downstream primer: 5' TGGTGTAACGCAGCCAATAGC 3';

[0057] The probe sequence is as follows:

[0058] 5' FAM-CCCGTTGAAAACC-MGB 3'.

[0059] The reaction mixture was Premix Ex Taq (Probe qPCR) produced by TaKaRa Company; the water was RNase-free Water produced by TaKaRa Company.

Embodiment 3

[0060] Example 3 Fluorescent quantitative PCR kit

[0061] The embodiment of the present invention provides a fluorescent quantitative PCR kit for preparing and detecting PDCoV, specifically a kit containing the fluorescent quantitative PCR detection reagent of Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer and a probe for detecting porcine deltacoronavirus, a fluorescent quantitative PCR kit as well as a method and application, wherein a nucleotide sequence of the primeris as follows: an upstream primer: 5'CGCTTAACTCCGCCATCAA 3', and a downstream primer: 5'TGGTGTAACGCAGCCAATAGC 3'; the sequence of the probe is as follows: 5'FAM-CCCGTTGAAAACC-MGB 3'. The invention has the benefits that the detection of the porcine deltacoronavirus can be achieved quickly and accurately by using the kit provided by the invention; the kit provided by the invention has good linear relation in the template range of 3.15*10<1>-3.15*10<8>copies*[mu]L<-1>, and the sensitivity is 100 times that of a conventional PCR; the kit is good in specificity, and has no cross-reactivity with other porcine viruses; a reproducibility test coefficient of variation is less than 1.3%; compared with the conventional PCR method, the method has a higher positive detection rate for clinical samples;in summary, the method is strong in specificity, high in sensitivity and good in reproducibility, and provides a rapid and accurate detection method for laboratory diagnosis and epidemiological investigation of the porcine deltacoronavirus.

Description

technical field [0001] The invention relates to the technical field of virus PCR detection, in particular to a primer and a probe for detecting porcine delta coronavirus, a fluorescent quantitative PCR kit, a method and an application. Background technique [0002] Since 2010, the worldwide outbreak of large-scale piglet diarrhea has caused huge economic losses to the pig industry, but the pathogen and its pathogenesis have not yet been fully understood. Most studies reported that the detection rate of porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV) in these large-scale piglet diarrhea was more than 60%. However, American scholars have found that a high proportion of porcine deltacoronavirus (Porcine deltacoronavirus, PDCoV) exists in these diarrheal pig herds. [0003] PDCoV is a member of the Nidoorder, Coronaviridae, Coronaviridae, and Deltacoronavirus genus. The virus was first reported in Hong Kong, China in 2012, and PDCoV was first detected...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/701C12Q2563/107C12Q2545/114Y02A50/30
Inventor 李晓菲秦立廷陈婷魏笑笑孙爱荣
Owner SHANDONG NEW HOPE LIUHE GROUP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap