Primer and probe for detecting porcine deltacoronavirus, fluorescent quantitative PCR kit as well as method and application

Abstract

The invention discloses a primer and a probe for detecting porcine deltacoronavirus, a fluorescent quantitative PCR kit as well as a method and application, wherein a nucleotide sequence of the primeris as follows: an upstream primer: 5'CGCTTAACTCCGCCATCAA 3', and a downstream primer: 5'TGGTGTAACGCAGCCAATAGC 3'; the sequence of the probe is as follows: 5'FAM-CCCGTTGAAAACC-MGB 3'. The invention has the benefits that the detection of the porcine deltacoronavirus can be achieved quickly and accurately by using the kit provided by the invention; the kit provided by the invention has good linear relation in the template range of 3.15*10<1>-3.15*10<8>copies*[mu]L<-1>, and the sensitivity is 100 times that of a conventional PCR; the kit is good in specificity, and has no cross-reactivity with other porcine viruses; a reproducibility test coefficient of variation is less than 1.3%; compared with the conventional PCR method, the method has a higher positive detection rate for clinical samples;in summary, the method is strong in specificity, high in sensitivity and good in reproducibility, and provides a rapid and accurate detection method for laboratory diagnosis and epidemiological investigation of the porcine deltacoronavirus.

Description

technical field [0001] The invention relates to the technical field of virus PCR detection, in particular to a primer and a probe for detecting porcine delta coronavirus, a fluorescent quantitative PCR kit, a method and an application. Background technique [0002] Since 2010, the worldwide outbreak of large-scale piglet diarrhea has caused huge economic losses to the pig industry, but the pathogen and its pathogenesis have not yet been fully understood. Most studies reported that the detection rate of porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV) in these large-scale piglet diarrhea was more than 60%. However, American scholars have found that a high proportion of porcine deltacoronavirus (Porcine deltacoronavirus, PDCoV) exists in these diarrheal pig herds. [0003] PDCoV is a member of the Nidoorder, Coronaviridae, Coronaviridae, and Deltacoronavirus genus. The virus was first reported in Hong Kong, China in 2012, and PDCoV was first detected...

AI Technical Summary

Problems solved by technology

These conventional methods are cumbersome to operate and take a long time to detect, some need 5-7 days or even longer to produce results

In addition, these conventional methods have insufficient specificity and sensitivity when used for PDCoV detection, especially when the virus content is low in the early stage of virus infection

Images