Primer and probe for detecting porcine deltacoronavirus, fluorescent quantitative PCR kit as well as method and application
A coronavirus and fluorescence quantitative technology, applied in the field of virus PCR detection, can solve the problems of long detection time, insufficient specificity and sensitivity, cumbersome operation, etc., and achieve high sensitivity, strong specificity and good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 Primers and Probes
[0046] The embodiment of the present invention provides a primer and probe for specific detection of PDCoV, wherein:
[0047] The primer sequences are as follows:
[0048] Upstream primer: 5' CGCTTAACTCCGCCATCAA 3',
[0049] Downstream primer: 5' TGGTGTAACGCAGCCAATAGC 3';
[0050] The probe sequence is as follows:
[0051] 5' FAM-CCCGTTGAAAACC-MGB 3'.
Embodiment 2
[0052] Example 2 Fluorescent quantitative PCR detection reagent
[0053] An embodiment of the present invention provides a fluorescent quantitative PCR detection reagent for detecting PDCoV, which includes the following components: reaction mixture, water, and primers and probes for detecting PDCoV; wherein,
[0054] The primer sequences are as follows:
[0055] Upstream primer: 5' CGCTTAACTCCGCCATCAA 3',
[0056] Downstream primer: 5' TGGTGTAACGCAGCCAATAGC 3';
[0057] The probe sequence is as follows:
[0058] 5' FAM-CCCGTTGAAAACC-MGB 3'.
[0059] The reaction mixture was Premix Ex Taq (Probe qPCR) produced by TaKaRa Company; the water was RNase-free Water produced by TaKaRa Company.
Embodiment 3
[0060] Example 3 Fluorescent quantitative PCR kit
[0061] The embodiment of the present invention provides a fluorescent quantitative PCR kit for preparing and detecting PDCoV, specifically a kit containing the fluorescent quantitative PCR detection reagent of Example 2.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



