Quintuple RT-PCR detection method for the pathogen of porcine viral diarrhea
A technology of RT-PCR and porcine viral diarrhea, which is applied in the field of five-fold RT-PCR detection technology for porcine viral diarrhea pathogens, can solve problems such as poor results, and achieve reduced workload, good specificity and repeatability , The effect of improving work efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] A five-fold RT-PCR detection method for the pathogen of porcine viral diarrhea,
[0045] In the first step, design primer pairs for specific RT-PCR detection of 5 viruses:
[0046] Primer pair sequences for detection of porcine deltacoronavirus (Porcine Deltacoronavirus, PDCoV):
[0047] The primer sequence of the upstream primer PD-Detection (F) is 5'-TACAACCTAAGGCTAACCAAC-3',
[0048] The primer sequence of the downstream primer PD - Detection (R) is 5'- ACAACTTTACCTGCCTTACATA - 3';
[0049] Primer pair sequences for detection of Porcine Torovirus (PToV):
[0050] The primer sequence of the upstream primer PT-Detection (F) is 5'-TCCTCGTGACACTTTATCTCA-3',
[0051] The primer sequence of the downstream primer PT-Detection (R) is 5'-TTCACTAACATCCTCTACCCACA-3';
[0052] The sequence of the primer pair used to detect porcine epidemic diarrhea virus (Porcine Epidemic Diarrhea Virus, PEDV):
[0053] The primer sequence of the upstream primer PE - Detection (F) is 5'- TG...
Embodiment 2
[0069] The five-fold RT-PCR detection method of porcine viral diarrhea disease pathogen comprises the following steps:
[0070] In the first step, design primer pairs for specific RT-PCR detection of 5 viruses:
[0071] Primer pair sequences for detection of porcine deltacoronavirus (Porcine Deltacoronavirus, PDCoV):
[0072] The primer sequence of the upstream primer PD-Detection (F) is 5'-TACAACCTAAGGCTAACCAAC-3',
[0073] The primer sequence of the downstream primer PD - Detection (R) is 5'- ACAACTTTACCTGCCTTACATA - 3';
[0074] Primer pair sequences for detection of Porcine Torovirus (PToV):
[0075] The primer sequence of the upstream primer PT-Detection (F) is 5'-TCCTCGTGACACTTTATCTCA-3',
[0076]The primer sequence of the downstream primer PT-Detection (R) is 5'-TTCACTAACATCCTCTACCCACA-3';
[0077] The sequence of the primer pair used to detect porcine epidemic diarrhea virus (Porcine Epidemic Diarrhea Virus, PEDV):
[0078] The primer sequence of the upstream prim...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


