Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

39 results about "Infectious gastroenteritis" patented technology

Composition comprising soluble glucan oligomer from saccharomyces cerevisiae is2 inhibiting the swine influenza (SIV) and transmissible gastroenteritis coronavirus (tgev)

InactiveUS20060178341A1Easy to useBiocideOrganic active ingredientsInsoluble glucanCell wall
The present invention relates to the soluble glucan oligomer having a M.W. ranging from 1,000 to 10,000 prepared by treating insoluble beta-glucan isolated the cell wall of yeast variant IS2 with commercially available beta-glucan hydrolyzing enzymes. The soluble glucan oligomer showed potent efficacy on inhibiting activity of influenza virus and transmissible gastroenteritis coronavirus, therefore, it can be used as the therapeutics or health care food for treating and preventing mammal's diseases caused by the infection of influenza virus and transmissible gastroenteritis coronavirus.
Owner:MOON WON KOOK +3

Preparation method of compound egg yolk antibody medicinal preparation for preventing and treating piglet virus epidemic disease

A compound yolk antibody preparation for preventing the viral diseases of piglet, including viral diarrhea of piglet is prepared through providing the vaccines of infectious gastroenteritis, epidemic diarrhea and rotavirus, immunizing with them sequentially by three turns, collecting immunized eggs, taking yolk, diluting with aseptic buffer liquid of phosphate, treating by hydroxypropylmethyl cellulose phthalate, filtering, and spraying drying.
Owner:SHANGHAI JIAO TONG UNIV

Recombination Lactococcus lactics for expressing pig infectious gastroenteritis virus S protein and preparation method thereof

The invention provides a recombination lactic acid galactococcus method of expessing pig transmissible gastroenteristis virus mutation S protein, which comprises the following steps: designing double primers according to the total gene order of pig Transmissible gastroenteristis virus S protein and gene fusion characteristic of expressing the carrier plasmid; proceeding PCR; getting the 2007bp destination fragments of four main antigen sites with TGEV S gene; connecting with the carrier plasmid PNZ8112 of secretory expression; getting into the host lactic acid galactococcus NZ9000 cell by electric conversion; expressing under the inducing of nisin. The invention constructs the expression carrier system of coronaviridae TGEV S mutein lactic acid galactococcus, which expresses about 66KDa destination protein of four main antigen sites with TGEV. Immunological ink mist experiment and indirect immunological fluorescein test indicate that the exogenesis protein is able to react with TGEV immunological serum and the recombination S protein has the same antigenic as TGEV natural antigenic.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Traditional Chinese medicine composition for treating porcine transmissible gastroenteritis

The invention provides a traditional Chinese medicine composition for treating porcine transmissible gastroenteritis. The traditional Chinese medicine composition comprises the following active pharmaceutical ingredients: costustoot, natural indigo, common goldenrod, perfoliote knotweed herb, cochinchnese asparagus root, fresh bamboo sap, pterocephalus hookeri, coix seed, common St. Paulswort herb, entada phaseoloides, tree-of-heaven ailanthus bark, small centipeda herb, Japanese flowering fern rhizome, kudzuvine root, ovateleaf holly bark, south dodder seed, rhizome, abelmoschus manihot, amur corktree bark, Chinese taxillus twig, bistort rhizome, pilose Asiabell root and ash bark. The traditional Chinese medicine composition can overcome the shortcomings of the existing western medicine therapy and has the advantages of good efficacy against the porcine transmissible gastroenteritis, low toxicity and side effects, less residue, rich resources and low price.
Owner:QINGDAO AGRI UNIV

RAA primer probe for detecting Nipah viruses as well as detection method

The invention discloses a primer and a probe for detecting Nipah viruses by an RAA fluorescence method as well as a detection method, wherein the primer and the probe are suitable for RAA fluorescencemethod detection, Nipah virus plasmid can be detected, cross reaction with Hendra virus plasmid, foot and mouth disease viruses, porcine parvoviruses, pseudorabies viruses, porcine circoviruses, epidemic type b encephalitis viruses, reproductive and respiratory syndrome viruses, hog cholera viruses and infectious gastroenteritis viruses can be avoided, and the specificity reaches to 100 percent;the detection method is rapid, high flux is easy to realize, the detection time and the detection cost are reduced; and according to the method for rapidly detecting Nipah virus DNA based on the RAA fluorescence method, the sensitivity is high, and 74 copies / reaction is realized under the probability that the reaction detection sensitivity is 95 percent.
Owner:CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT +1

Piglet drug-resistant colibacillosis treating traditional Chinese medicine composition

The present invention discloses a piglet drug-resistant colibacillosis treating traditional Chinese medicine composition, which comprises 5-40% of cortex phellodendri, 5-40% of scutellaria baicalensis georgi, 5-40% of hypericum perforatum l, 5-40% of valeriana jatamansi jones, 5-40% milkvetch root, and 5-40% of acorus tatarinowii. According to the present invention, the product can treat piglet infectious diseases caused by drug-resistant Escherichia coli, infectious gastroenteritis viruses or epidemic diarrhea viruses, and does not have adverse reactions, drug residues and drug resistance during the use process; the product adopts berberine, phillyrin and hyperoside as the quantitative indexes and adopts the control substances of berberine, phillyrin, hypericum perforatum l, valeriana jatamansi jones, milkvetch root and acorus tatarinowii as the identification indexes so as to control the quality; and the safety test results and the clinical trial results prove that the granular dosage form of the product is safe and effective.
Owner:SHENYANG VICA ANIMAL HUSBANDRY TECH +1

Traditional Chinese medicine composition for treating piglet epidemic diarrhea

The invention discloses a traditional Chinese medicine composition for treating piglet epidemic diarrhea. The traditional Chinese medicine composition consists of four traditional Chinese medicines: hypericum perforatum, astragalus membranaceus, rhizoma acori graminei and jatamans valeriana rhizome. Powder, oral liquid and granules prepared from the traditional Chinese medicine composition can be used for treating the piglet epidemic diarrhea, piglet colibacillosis and infectious gastroenteritis.
Owner:SHENYANG VICA ANIMAL HUSBANDRY TECH +1

Medicinal composition for treating infectious gastroenteritis of piglet

The invention discloses a medicinal composition for treating infectious gastroenteritis of a piglet. The medicinal composition includes the following constituents: 50-70 parts of pericarpium granati, 50-70 parts of ciliatenerve knotweed roots, 50-70 parts of flos hibisci, 40-60 parts of pulsatilla chinensis, 40-60 parts of sargentodoxa cuneata, 40-60 parts of patrinia villosa juss, 40-60 parts of fried coix seeds, 30-50 parts of dendranthema indicum, 30-50 parts of acalypha australis, 20-40 parts of agrimonia pilosa, 3-7 parts of berberine powder, 3-7 parts of piglet special bacteria and 3-7 parts of vitamin B complex. Through organic combination, dialectical compatibility and mutual assistance of the constituents, the functions of the medicinal composition for clearing heat, drying dampness and curing diarrhea is strengthened, and the purpose of curing diarrhea of the piglet is achieved; the medicinal composition can effectively prevent the piglet from suffering infectious gastroenteritis, is safe and nontoxic with a definite curative effect, and can improve the immunity of animals and the breeding benefit. Clinical trials prove that the cure rate of the medicinal composition for piglet diarrhea is 93.15%, with an effective rate of 98.97%.
Owner:JILIN AGRICULTURAL UNIV

Recombinant lactococcus lactis expressing S600 gene of transmissible gastroenteritis virus of pigs and application

The invention discloses a recombinant lactococcus lactis expressing the S600 gene of a transmissible gastroenteritis virus of pigs and application. A constitutive expression vector pMG36e of lactococcus lactis MG1363 is utilized for expression. Lactococcus lactis is a generally regarded as safe (GARS) microorganism, and has a beneficial regulating effect on the growth of an animal. When a constitutive expression system of lactic acid bacteria expresses target protein, no inducer is required. In the process of self growth division, foreign target protein is synthesized, and toxicity and side effects in products caused by the inducer can be eliminated. A new mucosal immunity vaccine of infectious gastroenteritis of pigs is mixed with feed to obtain a mixture, and then the mixture is fed to pregnant sows and piglets for a period of time to prevent and control diseases such as viral diarrhea of pigs caused by the transmissible gastroenteritis virus of pigs.
Owner:HUAZHONG AGRI UNIV

Compound for preventing and controlling porcine virus diseases

InactiveCN102151288AAdvantage preventionAdvantageous therapeuticOrganic active ingredientsAntiviralsDiseaseSide effect
The invention relates to a compound for preventing and controlling porcine virus diseases and a preparation method thereof, in particular to a compound for preventing and controlling porcine virus diseases. The compound is formed by mixing and preparing the following raw materials proportioned by weight portion: 1-5 portion(s) of porcine plasma protein powder and 1-3 portion(s) of astragutus pokysacharin. The compound has reasonable prescription and strong swine antivirus ability. The preparation method has advanced process, ensures the preparation to be stable and realizes long storage period. The drugs in the compound have extensive sources, have no side effect, difficultly generate the drug resistance and conform to the international health inspection standard. The compound is particularly suitable for treating infectious gastroenteritis diseases, atypical swine fever, rotavirus diseases, porcine epizootic diarrhea and other diseases.
Owner:TIANJIN ASIAN BIOENG

Porcine interferon-gamma composite medicament and application thereof

The invention relates to a porcine interferon-gamma composite medicament and application thereof, belonging to the technical field of rear livestock medicaments. Per liter of porcine interferon-gamma composite medicament injection is prepared from the following raw materials: 400-500ml of porcine interferon-gamma, 100-180g of astragalus mongholicus extract, 100-180g of golden cypress extract, 100-180g of coptis extract, 20-30g of codonopsis extract, 40-80g of licorice extract and 2-8g of bursin. The porcine interferon-gamma composite medicament injection has a good effect in the processes of treating and preventing piglet infectious gastroenteritis and pig epidemic diarrhea, and the effective prevention rate is above 85%.
Owner:山东华辰制药有限公司

Primers and probes for detecting porcine infectious gastroenteritis virus, fluorescent quantitative PCR kit, method and application

The invention discloses a primer and a probe for detecting porcine infectious gastroenteritis virus, a fluorescent quantitative PCR kit, a method and application, wherein, nucleotide sequence of primis as follows: upstream prim: 5' TTGTCTGGGTTGCCAAGGAT 3', downstream primer: 5' TCATTATTAGCACCACGACTACCAA 3'; the sequence of the probe is as follows: 5' FAM-CCATGAACAAACCAAC-MGB 3'. The invention hasthe advantages that: the reagent kit of the invention can quickly and accurately realize the detection of the porcine infectious gastroenteritis virus; the method is specific, sensitive and reproducible. The method and application provides a rapid and accurate method for the laboratory diagnosis and epidemiological investigation of porcine infectious gastroenteritis virus.
Owner:SHANDONG NEW HOPE LIUHE GROUP

Tetrad egg yolk antibody soluble powder for resisting swine epidemic diarrhea, swine fever, pseudorabies and infectious gastroenteritis, and preparation method thereof

The invention belongs to the technical field of immunology and antibody preparation, in particular to a tetrad egg yolk antibody soluble powder for resisting swine epidemic diarrhea, swine fever, pseudorabies and infectious gastroenteritis and a preparation method thereof. As that dry dextrin and the maltodextrin are use as carriers, Fulvic acid will be adde, Resistance of sucrose, potassium sorbate and sodium azide to classical swine fever, swine pseudorabies, Tetrad yolk antibodies against porcine epidemic diarrhea and porcine infectious gastroenteritis were sprayed onto the carrier surface,A soluble powder with high purity, high stability, high curative effect and easy preservation is prepared, and is a preparation with specificity, good curative effect and quick curative effect for swine fever, swine pseudorabies, swine epidemic diarrhea and swine infectious gastroenteritis, and can effectively prevent and treat that four infectious diseases of swine.
Owner:北京普飞特生物科技有限公司

A vaccine against porcine transmissible gastroenteritis

ActiveCN104740626BStrong proliferationGamma-interferon highBacteriaMicroorganism based processesNucleotideSwine Transmissible Gastroenteritis
The invention discloses an application of recombinant salmonella containing nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 in preparation for a medicine for preventing swine transmissible gastroenteritis, and further discloses a vaccine for preventing swine transmissible gastroenteritis, which is prepared from recombinant salmonella containing nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, and pharmaceutically acceptable auxiliary materials or carriers. The vaccine disclosed by the invention is capable of inducibly producing two specific antibodies with regard to the S-protein and the N-protein of swine transmissible gastroenteritis virus (TGEV) simultaneously, has a double-gene immunologic function, a more comprehensive immunologic effect and a high level of the induced antibodies, as well as is capable of providing a more comprehensive protection function for swine transmissible gastroenteritis and excellent in clinical application prospect.
Owner:SICHUAN AGRI UNIV

A kind of porcine transmissible gastroenteritis virus n protein antibody titer assay method

The present invention relates to a method for measuring the titer of N protein antibody of porcine transmissible gastroenteritis virus, comprising the following steps: S1, experimental animal immunity test; including N protein immunization of Bactrian camels and N protein antibody titer; S2, constructing VHH Phage library; including amplification of VHH gene and display vector construction and nanobody library construction and library capacity determination; S3, panning N-specific nanobodies; including library rescue and recombinant phage titer determination, panning N protein-specific recombination Phage, protein-specific recombinant phage enrichment and crude extract preparation and ELISA detection of N protein recombinant nanobody.
Owner:SHANDONG VOCATIONAL ANIMAL SCI & VETERINARY COLLEGE

Recombination Lactococcus lactics for expressing pig infectious gastroenteritis virus S protein and preparation method thereof

The invention provides a method for expressing the recombinant Lactococcus lactis of porcine transmissible gastroenteristis virus (Transmissible gastroenteristisvirus, TGEV) spike S protein. According to the complete gene sequence of the porcine transmissible gastroenteritis virus S protein and the gene fusion characteristics of the expression vector plasmid, a pair of primers were designed and PCR was carried out to obtain a 2007bp target fragment containing the four main antigenic sites of the TGEV S gene, which was combined with The vector plasmid pNZ8112 for secreted expression was connected, and transformed into host bacteria Lactococcus lactis NZ9000 cells by electrotransformation, and expressed under the induction of nisin. In the present invention, a coronavirus TGEV S protein Lactococcus lactis expression vector system is constructed, and the target protein of about 66KDa containing four main antigenic sites of TGEV S protein A, B, C, and D is expressed, and western blot experiments and indirect immunofluorescence The tests all showed that the expressed foreign protein could react with TGEV immune serum, indicating that the recombinant S protein had the same antigenicity as the TGEV natural antigen.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Quintuple RT-PCR detection method for the pathogen of porcine viral diarrhea

This application discloses a five-fold RT-PCR detection method for the pathogen of porcine viral diarrhea disease, in which the five pairs of primers are the detection primers of porcine delta coronavirus (also known as porcine D-coronavirus) and the detection primers of porcine protuberance virus , Porcine epidemic diarrhea virus detection primers, porcine acute diarrhea syndrome coronavirus detection primers, transmissible gastroenteritis virus detection primers. Using the nucleic acid or reverse transcription product of the sample to be tested as a template, use 2×Taq Plus Master Mix to perform PCR amplification using 5 pairs of primers in this application. The patent allows simultaneous detection of up to five viruses that can cause diarrhea in pigs in one PCR reaction tube, and its detection sensitivity reaches an initial template concentration of 1×10 per microliter 3 copies (1×10 3 copies / μL), and has excellent specificity and repeatability, and can be directly applied to the detection of clinical samples.
Owner:华派生物技术(集团)股份有限公司

Medicine for treating animal enterogastritis and its preparing method

Medicine for treating animal enterogastritis and its preparing method, wherein the medicine is prepared from andrographolide, Mequindoc, berberine,atropine, trimethoprim, sodium salicylate propylene glycol through extraction, filtering, lixiviating, concentrating, mixing, stirring, sterilizing, loading and printing.
Owner:韶山市世源兽药厂

A kind of freeze-drying protective agent of porcine transmissible gastroenteritis and porcine epidemic diarrhea dual live vaccine and dual live vaccine

The present invention provides a freeze-dried protective agent for porcine infectious gastroenteritis and porcine epidemic diarrhea combined live vaccine and a combined live vaccine. , gelatin 6-10%, tryptone 2-6%, yeast extract powder 1-3%, chondroitin sulfate 0.1-2% and inositol 1-5%, the balance is water for injection, and the unit of mass-volume ratio is g / ml, the dual live vaccine includes the freeze-drying protective agent, which can effectively solve the problems of the existing freeze-dried products having depressions and cracks on the surface, slow dissolving speed of the freeze-dried products and loss of titer after freeze-drying.
Owner:SICHUAN HUASHEN ANIMAL BIOLOGICAL PRODS

Fodder used for preventing and controlling swine transmissible gastroenteritis and preparing method of fodder

The invention provides a fodder used for preventing and controlling swine transmissible gastroenteritis. The fodder is prepared from extruded corn, wheat middling, bone meal, whey powder, swelling soya dreg, imported fish meal, edible salt, premix and fodder additives, by improving matching of the raw materials, the content of nutrient elements like protein is increased, the nutrients are richer, the immunity of swine is improved, and the fodder is better preferred and secured by consumers. The fodder used for preventing and controlling swine transmissible gastroenteritis contains the fodder additives, can kill insects and germs, and therefore effectively prevent and control swine transmissible gastroenteritis. By using the fodder for preventing and controlling swine transmissible gastroenteritis, the quality of swine can be improved, the growth of the swine is effectively promoted, the morbidity of piglet transmissible gastroenteritis is drastically lowered, and therefore the interests of farmers are guaranteed.
Owner:安徽华米生物科技有限公司

Porcine interferon-gamma composite medicament and application thereof

The invention relates to a porcine interferon-gamma composite medicament and application thereof, belonging to the technical field of rear livestock medicaments. Per liter of porcine interferon-gamma composite medicament injection is prepared from the following raw materials: 400-500ml of porcine interferon-gamma, 100-180g of astragalus mongholicus extract, 100-180g of golden cypress extract, 100-180g of coptis extract, 20-30g of codonopsis extract, 40-80g of licorice extract and 2-8g of bursin. The porcine interferon-gamma composite medicament injection has a good effect in the processes of treating and preventing piglet infectious gastroenteritis and pig epidemic diarrhea, and the effective prevention rate is above 85%.
Owner:山东华辰制药有限公司

Oral liquid for preventing and treating diarrhea of bred pigs and preparation method of oral liquid

The invention relates to an oral liquid for preventing and treating diarrhea of bred pigs. The oral liquid comprises the following components in parts by weight: 2-6 parts of colistin sulfate, 1-5 parts of gentamicin sulfate, 2-6 parts of discolor cinquefoil herb, 1-5 parts of wrinkled gianthyssop herb, 3-7 parts of yerbadetajo herb, 1-5 parts of tree-of-heaven ailanthus bark, 4-8 parts of alpine yarrow herb, 4-8 parts of asiatic pennywort herb, 4-8 parts of common andrographis herb, 1-5 parts of bitter wood, 1-5 parts of green tangerine peel and 1-5 parts of Indian buead. The oral liquid has the advantages of scientific and reasonable formula composition, simple process, convenient use and relatively low cost, and the oral liquid can treat diseases of an intestinal system by sterilizing, stopping diarrhea and repairing intestinal mucosa. The oral liquid has great effects for preventing and treating epidemic diarrheal diseases, infectious gastroenteritis, diarrhea caused by rotavirus and other reasons and the like of the bred pigs.
Owner:TIANJIN REBATE SCI & TECH DEV

Application of all-trans retinoic acid in the preparation of anti-porcine infectious gastroenteritis virus drugs

The invention discloses the application of all-trans retinoic acid in the preparation of an anti-porcine infectious gastroenteritis virus drug. Acid mainly exerts its antiviral effect by inhibiting the replication of porcine infectious gastroenteritis virus. As the concentration of all-trans retinoic acid increases, the inhibitory effect is more obvious. It is safe and toxic for anti-porcine infectious gastroenteritis virus. It has few side effects, is easily metabolized and absorbed by the animal body, and the animal waste does not pollute the environment.
Owner:SICHUAN AGRI UNIV

A detection kit for porcine transmissible gastroenteritis virus antibody

The present invention relates to a porcine transmissible gastroenteritis virus antibody detection kit, the detection method is competition ELISA, the kit uses the protein of the amino acid sequence shown in SEQ ID No.1 as the competitive antibody in the detection reagent, and the Anti-N protein antibodies compete for binding to N protein. The results of the antiviral test showed that when the inoculated dose was 0.01 MOI, the nanobodies all showed inhibitory effect on virus replication on ST cells.
Owner:SHANDONG VOCATIONAL ANIMAL SCI & VETERINARY COLLEGE

Recombinant Lactococcus lactis expressing and secreting single-chain antibody against porcine transmissible gastroenteritis virus and its preparation method

A recombinant Lactococcus lactis expressing and secreting anti-porcine transmissible gastroenteritis virus single-chain antibody and its preparation method. A fusion sequence, the fusion sequence has the amino acid sequence shown in SEQ ID No.4. The single-chain antibody secreted by the recombinant Lactococcus lactis can specifically bind to the porcine transmissible gastroenteritis virus, and can be used to block the infection of the porcine transmissible gastroenteritis virus and provide protection for piglets infected with the virus.
Owner:SHANGHAI JIAOTONG UNIV

Pork pig breeding method capable of preventing infectious gastroenteritis

The invention relates to a pork pig breeding method capable of preventing infectious gastroenteritis. The method comprises the steps that breeding pigs are obtained through artificial insemination and hybridization by taking pure-breed wild pigs as male parents and taking black sows as female parents; pork pigs are obtained through artificial insemination and hybridization by taking the breeding pigs as male parents and taking common sows as female parents; the pork pigs are fed on fermentation feed, wherein the fermentation feed is prepared from, by weight, 22-32 parts of corn stalks, 25-35 parts of cassava dregs, 14-24 parts of wheat, 2-4 parts of dried shredded ginger, 3-5 parts of shaddock peel and 1-2 parts of radix codonopsis. Compared with the prior art, the pork pig breeding method has the advantages that the adaptive capacity can be improved, the disease resistance can be enhanced, the growth speed is high, and the infectious gastroenteritis can be prevented.
Owner:柳州市宏华种猪有限公司

Shuanghuanglian for injection as a compound preparation of Chinese veterinary medicine and its preparation process and application

The invention relates to Shuanghuanglian for injection as a compound preparation of traditional Chinese veterinary medicine and its preparation process and application. The compound preparation of the present invention is prepared from the following medicines in parts by weight: 1250-3750 parts of honeysuckle, 1250-3750 parts of scutellaria baicalensis and 2500-7500 parts of forsythia. Sustained-release excipients are 200 parts of hydroxypropylmethylcellulose and 100 parts of sodium carboxymethylcellulose. Because it contains slow-release excipients, it can reduce the number of injections for large animals and reduce the stress response of large animals. The veterinary traditional Chinese medicine injection preparation of the invention has the effects of antiviral, antibacterial, anti-inflammatory, antipyretic and analgesic, and improving immunity. Its veterinary medicine can be used for coughs caused by epidemic diarrhea, infectious gastroenteritis, piglet paratyphoid, sepsis caused by various epidemic diseases, streptococcal disease, haemophilus parasuis, infectious pleuropneumonia, swine lung disease, etc. , dyspnea, cyanosis of the skin, joint swelling, lameness, porcine reproductive and respiratory syndrome, mastitis of cows.
Owner:JIANGXI ZHONGCHENG MEDICINE GROUP
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More