A method for multiple amplification library construction for trace dna and its special kit

A technology of multiple amplification and DNA library, which is applied in the field of multiple amplification library construction method and its special kit, which can solve the problems of high indel detection error rate, non-universal library construction products, cumbersome steps, etc., to reduce sequencing background errors , improve sequencing quality, and facilitate operation

Active Publication Date: 2022-02-01
CAPITALBIO CORP
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Life's related kits are relatively economical in single-round operation costs, but are not suitable for polyN type mutation detection due to technical limitations, and the indel detection error rate is relatively high
Although the Illumina platform has a relatively low sequencing error rate, its library construction first requires a series of reactions such as end repair, phosphorylation, and A addition of nucleic acids, and then uses Y-shaped sticky-end adapters for ligation. After the ligation is completed, the library is amplified. Sequencing can only be carried out, which is costly and cumbersome
Due to the different adapters used by the two platforms, the library construction products cannot be used universally on the two platforms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for multiple amplification library construction for trace dna and its special kit
  • A method for multiple amplification library construction for trace dna and its special kit
  • A method for multiple amplification library construction for trace dna and its special kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1. The sequencing linker of the present invention and its application in building a trace DNA library.

[0065] 1. The sequencing adapter of the present invention

[0066] 1. Preparation of adapter sequences

[0067] Prepare the linker sequence as follows:

[0068]adoligo1: T*A*A*TA*CACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T(sequence 1);

[0069] adoligo2: G*C*C*T*GTGACTGGAGTTCAGACGTGTGCTCTTCCG*A*T*C*T (sequence 2);

[0070] adlogo3: A*G*A*T*CGGAA*G*A*G*C (sequence 3);

[0071] Among them, * indicates thio modification.

[0072] 2. Preparation of Adaptor1 and Adaptor2 linkers

[0073] (1) Prepare adoligo1, adoligo2, and adoligo3 respectively into storage solutions with a final concentration of 500 μM.

[0074] (2) Mix adoligo1 and adoligo3 in equal molar numbers, configure the reaction system shown in Table 1, and react according to the procedure shown in Table 3 to form Adaptor1.

[0075] Mix adoligo2 and adoligo3 in equimolar amounts, configure the reaction s...

Embodiment 2

[0155] Embodiment 2, the fidelity comparison between the amplification library construction system of the present invention and the Ampliseq kit

[0156] The cfDNA quality control products with a mutation frequency of 5%, 1% and 0.5% (the cfDNA quality control products with a mutation frequency of 5% and 1% were purchased from Horizon Discovery Company in the United States, and the cfDNA quality control products with a mutation frequency of 0.5% The cfDNA quality control products with a mutation frequency of 0% and 1% purchased from Horizon Discovery in the United States were mixed and prepared according to the mass ratio of 1:1) as the samples to be tested, and the amplification library construction system of the present invention and Ampliseq were used respectively. The kit was used for amplification and library construction, and the fidelity of the two methods was compared. Specific steps are as follows:

[0157] 1. Construction of library

[0158] (1) Amplification libra...

Embodiment 3

[0177] Example 3, Multiple amplification at the single cell level and method for building a library

[0178] In this embodiment, 12 pg of gDNA at the single-cell level is used as a starting template to amplify and build a library (the preparation method of gDNA at the single-cell level is as follows: the fragmented human genome gDNA is fragmented with an ultrasonic breaker to obtain an average of 200 bp left and right fragmented human genome gDNA, which is then serially diluted to obtain gDNA at the single-cell level), and the amplification performance of the amplification library construction system of the present invention on picogram-level samples is tested. Specific steps are as follows:

[0179] 1. Multiple amplification of DNA at the single cell level

[0180] (1) Configure the amplification reaction system according to Table 4, blow and mix evenly, and centrifuge briefly to collect the liquid.

[0181] (2) Place it on the PCR instrument and run the program in Table 5....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for multiple amplification library building of trace DNA and a special kit thereof. The multiple amplification library construction method of the present invention can realize multiple amplification sequencing using trace DNA or even DNA at the single cell level as a template, and the entire reaction process can be realized in a single tube. It is proved by experiments that the library construction method of the present invention achieves up to 207 multiple amplifications of one-tube amplicons at the level of single cells, and the fidelity is higher than that of existing commercial kits, which not only has the advantages of convenient operation , low cost, high sequencing quality and high sensitivity, and can also meet the sequencing needs of the two sequencing platforms. It is suitable for the field of high-throughput low-frequency mutation detection, such as ctDNA mutation detection, and the field of germline mutation detection with low input DNA, such as single-cell mutation detection and screening.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for building a library with multiple amplification of trace DNA and a special kit thereof. Background technique [0002] Amplicon sequencing is the sequencing of PCR products or captured fragments of a specific length to analyze the variation in the sequence. Amplicon sequencing can perform high-coverage sequencing of the target region, which is convenient for low-frequency mutation detection, and is of great value in exploring genetic variations in complex samples (such as heterogeneous somatic mutations, etc.) for sequencing. In practical applications, the difficulty is how to prepare high-fidelity amplicon sequencing libraries for low DNA input samples (including low input samples with DNA degradation). [0003] The existing technical solutions for low initial quantities are mainly the multiple amplification technology of Life’s Ampliseq product, which has th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6869C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/6869C12Q2525/191C12Q2537/143
Inventor王辉黎一江郭弘妍邢婉丽程京
OwnerCAPITALBIO CORP