Transgenic soybean GST40-3-2 test primer, probe, kit and method

A technology of genetically modified soybeans and detection kits, which is applied in the field of molecular biology, can solve problems such as detection methods and kits for genetically modified soybeans that have not yet been detected, and achieve the effect of simple operation and strong specificity

Inactive Publication Date: 2018-12-21
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no detection method and kit for detecting transgenic soybean GST40-3-2 using RPA method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic soybean GST40-3-2 test primer, probe, kit and method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Design and screening of transgenic soybean GST40-3-2RPA detection primers and probes

[0029] The target region detected by GST40-3-2RPA in the present invention is the transformant-specific sequence of GST40-3-2, that is, the sequence of the junction region between the exogenous insert and the soybean genome, and the forward and reverse primers are respectively located at the two junctions of the junction point. side, while the probe covers the connection area.

[0030] (1) Primer design

[0031] 5 primers were respectively designed on both sides of the connection point, and the length of the primers was 30-32bp. The sequences of the screening primers of the present invention are as follows:

[0032] F1: GCTAATGAGTTATTTTTGCATGCTTTAATTTGT;

[0033] F2: TGCATGCTTTAATTTGTTTCTATCAAATGTTT;

[0034] F3: TTACTAGAAATAACTTATTGCATTTCATTCA;

[0035] F4:TTCATTCAAAATAAAGATCATACATACAGGTT;

[0036] R1: GCATCTTGAACGATAGCCTTTCCTTTATCGC;

[0037] R2: ACCACTGTCGGCAGAGGCAT...

Embodiment 2

[0045] Determination of embodiment 2RPA reaction system, amplification and detection conditions

[0046] (1) Determination of amplification temperature

[0047] Under the condition that other amplification conditions of RPA are the same, carry out RPA amplification in the temperature range of 30-45°C, determine the optimal amplification temperature of RPA according to the strength of the fluorescence signal intensity at different temperatures, and finally determine the optimal amplification The temperature was 39°C.

[0048] (2) Determine the concentration of primers and probes

[0049] Primers and probes were prepared at the same concentration, 10 μmol / L, and other amplification conditions of RPA were the same. Amplification was performed at the optimum amplification temperature of 39°C, and primers and probe combinations with different concentrations were amplified. The strength of the fluorescent signal intensity under the combination determines the optimal primer and pro...

Embodiment 3

[0050] The establishment of embodiment 3 kit and detection method thereof

[0051] The RPA detection kit of transgenic soybean GST40-3-2 was prepared according to the following formula, and the specification of each kit was 50 reactions:

[0052] (1) Detection primer and probe solution: Synthesize forward primer F, reverse primer R and probe P, and prepare the dry powder of primer and probe with sterilized deionized water or ultrapure water with a concentration of 10 μmol / L respectively. Mother liquor, wherein the primer sequences are:

[0053] Forward primer F: GCTAATGAGTTATTTTTGCATGCTTTAATTTGT (SEQ ID NO: 1);

[0054] Reverse primer R: GGTCCATCTTTGGGACCACTGTCGGCAGAG (SEQ ID NO: 2).

[0055] Probe P: TAAACATAGGGAACCCAAATGGAAAAGGAAGG[FAM-dT]G[THF]C[BHQ1-dT]CCTACAAATGCCATCAT-C3 Spacer (SEQ ID NO: 3).

[0056] (2) Buffer A (1.5mL): containing 50mmol / L Tris-HCl, pH 8.4, 80mmol / L KAc, 2mmol / LDTT, 3mmol / L ATP, 200μmol / L d NTPs, 20mmol / L C 4 h 10 N 3 o 5 P, 100ng / μL creatine ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transgenic soybean GST40-3-2 test primer, probe, kit and method. A primer group comprises 2 specific primers, of which nucleotide sequences are as shown in SEQ ID No.1 and SEQ ID No.2. A probe sequence is as shown in SEQ ID No.3. The test kit comprises a test primer and a probe solution, a Buffer A, a Buffer B and a positive control. The test method is characterized in that the specific primers and the probe are used for amplification of a sample DNA template at a temperature of 37-42 DEG C under the action of a recombinase, single-stranded DNA-binding protein (SSB),a strand displacement DNA polymerase and an exonuclease; and fluorescence signals of the probe are collected to judge whether a sample contains the transgenic soybean GST40-3-2 content or not. The transgenic soybean GST40-3-2 test primer, probe, kit and method provided by the invention has the characteristics of being rapid, high in efficiency, convenient to operate, high in sensitivity, high in specificity and the like; no special instruments are required; and the applicability for field tests is achieved.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection method for transgenic plants and products thereof, in particular to a primer and a method for rapidly detecting transgenic soybean GST40-3-2 using recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA). Probe panels, kits and assays. Background technique [0002] In 2016, the global planting area of ​​genetically modified crops reached 185.1 million hectares, an increase of more than 100 times compared with the initial commercialization in 1996. At present, the commercially grown transgenic crops mainly include soybean, corn, cotton, and rapeseed. Among them, transgenic soybean has the largest planting area in the world, reaching 91.4 million hectares in 2016, accounting for 50% of the total global transgenic crop area. Genetically modified soybean GST40-3-2 is a herbicide-resistant genetically modified soybean developed b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6844C12Q1/6895C12N15/11
CPCC12Q1/6844C12Q1/6895C12Q2521/507C12Q2531/119C12Q2537/1376C12Q2563/107C12Q2522/101
Inventor徐俊锋汪小福陈笑芸彭城徐晓丽魏巍
OwnerZHEJIANG ACADEMY OF AGRICULTURE SCIENCES