Cynoglossus semilaevis exosome gender difference expression label and kit

A technology of semi-smooth tongue sole and exosomes, applied in the field of semi-smooth tongue sole exosome sex differential expression labels and kits, can solve the problems of inaccurate results and achieve reliable identification results

Inactive Publication Date: 2018-12-21
TIANJIN BOHAI SEA FISHERIES RES INST
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although some methods are simple and easy to implement, the results may not be accurate, and some methods require dissection of fish

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cynoglossus semilaevis exosome gender difference expression label and kit
  • Cynoglossus semilaevis exosome gender difference expression label and kit
  • Cynoglossus semilaevis exosome gender difference expression label and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Screening and determination of semi-smooth tongue sole seminal plasma exosomes miRNAs as biomarkers

[0022] 1. Collection of semen samples Collect 50 semi-smooth tongue sole sexually mature male fish and pseudo-male semen each, 0.5ml semen from each tail is used for exosome separation and identification.

[0023] 2. Extraction of exosomes

[0024] (1) Transfer 0.5ml of semen sample to 1.5ml EP tube, place it at 4°C, centrifuge at 1200g for 15min to remove sperm cells, centrifuge at 15000g at 4°C for 20min to remove small cell impurities and debris, dilute 1 times with PBS, use 0.45um filter membrane Carry out pre-filtration, and then filter the filtrate through a 0.22um filter membrane.

[0025] (2) The samples were extracted with SBI ExoQuick-TC for Tissue Culture Media and Urine kit.

[0026] (3) After centrifugation, remove the supernatant, collect the lysate and transfer it to a 2ml tube without RNase.

[0027] 3. Identification of exosomes: Hitachi H600IV transmission elect...

Embodiment 2

[0033] Identification of male and pseudo-male fish using microRNA markers in semi-smooth tongue sole

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a cynoglossus semilaevis exosome gender difference expression label and a kit, belonging to the field of fish biotechnology. A micro ribonucleic acid (miRNA) gender label is dre-miR-10d-5p, and a sequence is TACCCTGTAGAACCGAATGTGTG; the problem of distinguishing reproductive genetic differences between male cynoglossus semilaevis and female pseudo-male cynoglossus semilaevis is solved. The marker miRNAs have the characteristic of significant difference expression of male fish and female pseudo-male fish, and are specific molecular recognition markers.

Description

Technical field [0001] The invention belongs to the field of fish biotechnology, especially the application field of marine fish semen exosomes markers, and specifically is a semi-smooth tongue sole exosomes gender differential expression label and kit. Background technique [0002] The growth rate of male and female semi-smooth tongue soles varies greatly, and pseudo-males exist to varying degrees in nature and in the breeding environment. The chromosomes of pseudo-male fish are ZW type, and its reproductive organs are the same as male fish, which can also produce sperm and breed offspring. Pseudo-male fish can also accumulate from generation to generation through genetics, which leads to an imbalance in the male-to-male ratio of semi-smooth tongue sole. Therefore, the development of a method for identifying the pseudo-male semi-smooth tongue sole not only has theoretical significance, but also has production value and market value. [0003] There are many ways to identify fish ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6879
CPCC12Q1/6879C12Q2600/158C12Q2600/166C12Q2600/178
Inventor 张博贾磊赵娜李仰真刘克奉高磊高燕
Owner TIANJIN BOHAI SEA FISHERIES RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap