38results about How to "Cause trauma" patented technology

The invention provides a method for judging antenatal parental right relation with SNP. The SNP is used as a genetic marker, and judgment of the antenatal parental right relation is conducted through cooperation of the SNP and the high throughput sequencing technology. Only 10 ml of maternal peripheral blood is needed, free DNA extracted from the maternal peripheral blood plasma contains the free DNA of a fetus already, so that only one sample of a mother and the fetus is needed. Due to the fact that only the venous blood of a pregnant woman needs to be extracted, operation is simple and convenient, the pregnant woman and the fetus cannot be damaged, and the fetus can be identified after 10 weeks of pregnancy.

The invention provides an integrated detection method for separating, enriching and detecting an exosome. The method comprises the following steps: designing and assembling a dual-membrane filtration chip, constructing an ELISA detection standard curve, collecting a sample, injecting and washing, performing chip ELISA detection, and performing data processing analysis. The invention also provides an integrated detection chip for separating, enriching and detecting a urine exosome. A reaction system and the detection method of the present invention can be used for detecting the content of a urine sample of a bladder cancer patient and the exosome in a supernatant of a bladder cancer cell line nutrient solution. The detection chip has characteristic of high specificity, generates no influence or wound on human body, and the detection method does not require the expensive precision experiment apparatus (such as an ultra centrifuge and a fluorescence microscope), and has large application prospect.

The invention provides a calculation method of blood flow reserve fraction, comprising the following steps: image acquisition: continuously acquiring a plurality of blood vessel images through a CT scanner; Establishing a first model: establishing a first model based on the plurality of blood vessel images; Determining a narrow segment: determining the narrow segment by the first model; Establishing a second model: eliminating a narrow segment of the first model; FFR calculation: that blood flow reserve fraction is calculate using the formula FFR=Pd/Pa, wherein Pd is the blood pressure of thestenosis segment in the first model and Pa is the blood pressure of the blood vessel correspond to the stenosis segment in the first model in the second model. The invention has the advantages of no need to use the medicine for dilating blood vessels in the process and no physiological trauma to the patient, and has the characteristics of safety, convenience, precision and the like.

The invention belongs to the field of nucleic acid diagnosis and treatment and specifically relates to miRNA associated with colorectal cancer and an application thereof. The miRNA associated with colorectal cancer is miR-1290. The invention provides an application of the miR-1290 used in preparing a kit for distinguishing a colorectal cancer sample and a normal sample in a blood sample of a subject. The invention confirms for the first time that the miR-1290 is a colorectal cancer-associated miRNA diagnosis marker, and a novel colorectal cancer progression detection index is established. On this basis, the invention provides a new application of the miR-1290 in initial diagnosis and rapid detection of colorectal cancer and a related universally applicable kit.

The invention discloses an automatic quenching production line, and belongs to the field of plate spring shaping and heat treatment equipment. The automatic quenching production line is characterized by comprising a stepping type quenching furnace, a plate spring bending shaping device and a quenching pond. The stepping type quenching furnace is linked with the plate spring bending shaping device through a mechanical hand, and the plate spring bending shaping device is linked with the quenching pond through an oil inlet mechanism. The plate spring bending shaping device comprises a shaping machine frame, a feeding mechanism, a length alignment mechanism, a width alignment mechanism, a shaping device and a material supporting lifting mechanism; the feeding mechanism, the length alignment mechanism, the width alignment mechanism, the shaping device and the material supporting lifting mechanism are installed on the shaping machine frame. Heating, shaping and quenching operation of a plate spring can be automatically implemented, various working procedures are automatically and continuously executed, linage is compact, and the product production efficiency and the output quality are greatly improved.

The invention provides a coronary blood-flow volume acquiring method. The coronary blood-flow volume acquiring method comprises acquiring coronary image information to acquire coronary geometrical characteristic data; according to the coronary geometrical characteristic data, acquiring the total volume V of a coronary reference lumen, and calculating the blood-flow volume Q of an coronary openingaccording to a following formula, wherein, when the unit of Q is mm3/s and that of V is mm3, K ranges between 5 and 9.5. The invention also provides a coronary blood-flow speed acquiring method. According to the coronary blood-flow volume and speed acquiring method, the coronary blood-flow volume and speed can be acquired through the coronary image information; compared with a method for estimating coronary blood-flow volume according to myocardium size in the prior art, the coronary blood-flow volume and speed acquiring method can provide more accurate boundary conditions for image-based hamodynamic calculation.

The invention discloses an intermediate-advanced stage cancer imaging detecting system and an intermediate-advanced stage cancer imaging detecting method based on the quantum superstring engine, mainly used for overcoming the defect that the traditional medical device can not efficiently, safely, rapidly and comprehensively detect the cancer cell spreading area of a cancer patient. The intermediate-advanced stage cancer imaging detecting system comprises a quantum light emission source, an optical splitter, a convex lens, a light filter group, a detection unit, an image processing unit and a display. The intermediate-advanced stage cancer imaging detecting method comprises the steps that orthogonal polarized photons generated by the quantum light emission source pass through the optical splitter, and then are transmitted in two paths; one path of the orthogonal polarized photons irradiates the body of the patient through the convex lens and light filters, penetrates through the body and then is received by a detector, and the other path of the orthogonal polarized photons directly passes through the light filters, and are received by another detector; the detection unit carries out combined measurement on the photons detected by the two detectors, and outputs a detection result to the image processing unit, the image processing unit draws a diffusion area imaging picture of cancer cells in the body of the patient, and the diffusion area imaging picture is displayed by the display. With the adoption of the intermediate-advanced stage cancer imaging detecting system and the intermediate-advanced stage cancer imaging detecting method, the diffusion area imaging picture of the cancer cells can be obtained, and thus a basis is provided for the treatment and research on the cancer patient.

A tubular inserter with freezing probe and able to be curved in cavity for the freeze therapy in seophagus cavity and bronchus cavity has a regulating valve, a connector connected to said regulating valve and with tube inlet, air exhaust outlet and electric plug, an inserted flexible tube containing a freezing tube and the electric line, and a freezing probe at the front end of said flexible tube and with a temp sensor on its inner surface.

The invention provides a thighbone lesser trochanter fixing device used for clinical orthopedic surgery. The device comprises two handles which are connected through a hinge, wherein a first handle is arc-shaped on one side of the hinge and is linear on the other side of the hinge, the second handle is linear, an arc-shaped end of the first handle is provided with an arc-shaped cover, one end of the second handle is provided with an arc-shaped cover, the arc-shaped cover of the second handle and the arc-shaped cover of the first handle are arranged on the same side, an opening of one arc-shaped cover faces the other arc-shaped cover, a through hole is formed in each arc-shaped cover, a sleeve is installed in the through hole of the arc-shaped cover of the second handle, and one end of the first handle and one end of the second handle, away from the arc-shaped covers, are provided with limiting strips. The fixing devices can effectively fix the thighbone lesser trochanter, meanwhile can improve precision of punching of an electrical drill, and is beneficial for proceeding of an operation.

The invention relates to a cynoglossus semilaevis exosome gender difference expression label and a kit, belonging to the field of fish biotechnology. A micro ribonucleic acid (miRNA) gender label is dre-miR-10d-5p, and a sequence is TACCCTGTAGAACCGAATGTGTG; the problem of distinguishing reproductive genetic differences between male cynoglossus semilaevis and female pseudo-male cynoglossus semilaevis is solved. The marker miRNAs have the characteristic of significant difference expression of male fish and female pseudo-male fish, and are specific molecular recognition markers.

The invention relates to a glucose electrode, a micro-fluidic chip, a micro-fluidic passive sweat patch, and a preparation method and application of the micro-fluidic passive sweat patch. The glucose electrode comprises a substrate electrode, and a polyaniline film and a glucose oxidase film which are sequentially coated on the surface of the substrate electrode. An ion-selective glucose electrode is formed by modifying an ion-selective film on the substrate electrode, passive detection of glucose in sweat is realized by utilizing the ion-selective electrode for the first time, the principle is that glucose oxidase catalyzes glucose to generate hydrogen ions, and then the hydrogen ion-selective electrode is used for detecting the generated hydrogen ions, furthermore, the glucose concentration is calculated, and no trauma is caused to a tested person. The micro-fluidic chip and a micro-fluidic passive sweat patch which are prepared from the glucose electrode have excellent performance and wide application prospect.

The invention relates to an ultrasonic vital energy and blood circulation massage health-care helmet device. The ultrasonic vital energy and blood circulation massage health-care helmet device comprises a front half helmet shell, a rear half helmet shell, a front ultrasonic air bag module, a rear ultrasonic air bag module and a controller mechanism; the front ultrasonic air bag module is arrangedon the inner cavity wall of the front half helmet shell; the rear ultrasonic air bag module is arranged on the inner cavity wall of the rear half helmet shell; the front half helmet shell and the rearhalf helmet shell are hinged and covered together; and the controller mechanism consists of a main case, a PLC circuit control board, an electric inflator pump, an electromagnetic switch valve, a barometer and an ultrasonic generator. According to the helmet device, the whole head and the face of a human body can be completely wrapped with the airbags in a fitted manner, wearing is comfortable, the whole head and the face of the human body are subjected to ultrasonic vibration massage through an ultrasonic transducer, skin and hair are not damaged, and the helmet device has good health-care efficacy in promoting blood circulation of the whole head and face, soothing nerves, relieving fatigue, maintaining human metabolism and the like.

The invention discloses an ear-hanging device equipped by an electric power regulation and control attendant, comprising an ear-hanging main body which is of a cavity structure; one end of the ear hanging device is provided with a hook body bending toward the ear-hanging main body; the other end of the ear-hanging main body is provided with a battery chamber; an indication lamp panel is positioned on the upper part of the end surface, which is on the contrary to one end surface of the ear-hanging main body corresponding to the hook body; the middle part of the end surface is provided with a switch panel; the free end of the hook is provided with a buzzer; an inclination angle sensor and a programming controller which are mutually connected are arranged inside the cavity of the ear-hearing main body; and the inclination angle sensor is provided with a normally open contact switch which is connected to the programming controller. The ear-hanging device disclosed by the invention wakes up the regulation and control attendant who is about to go into a deep sleep state through deflection sensing of the inclination angle sensor and the programming controller controlling the working state of the buzzer, and enables the attendant to focus and finish the detection work.

The invention discloses a snake-proof henhouse for breeding mountain chickens. The henhouse comprises a henhouse body, a movable doorplate, a device for preventing snake crawling, a snake-proof pit, asnake-killing door, an illumination-ventilation device, and a feeding device. The device for preventing snake crawling is arranged on the outer wall of the henhouse body and two sides of the movabledoorplate. The snake-proof pit is arranged close to the movable doorplate. The illumination-ventilation device and the feeding device are both arranged in the henhouse body. The movable doorplate is movably arranged on one surface of the henhouse body. The movable doorplate is movably connected to the henhouse body through a rotation shaft. The device for preventing snake crawling comprises a fixed rod. The fixed rod is fixedly connected to the outer wall of the henhouse body. The provided snake-proof henhouse can prevent snakes from entering the henhouse, the mountain chickens and eggs are protected effectively, the loss is reduced, in the henhouse, mountain chickens can exercise through small earth mounds, a first support rod and a second support rod, and the taste of chicken is improved.

The invention discloses piRNA (piwi-interacting ribonucleic acid) biomarkers for noninvasive early-stage diagnosis on colon cancer and rectal cancer and a detection kit. The piRNA biomarkers comprisepiRNA020619 and piRNA020450. The expression amounts of the two piRNA biomarkers in serum of patients suffering from colon cancer and rectal cancer are remarkably higher than those in serum of healthypeople, and the piRNA biomarkers have very high sensitivity and specificity when being adopted to diagnose colon cancer and rectal cancer. By adopting the kit disclosed by the invention, serum samplesof patients suffering from colon cancer and rectal cancer and serum samples of healthy people can be rapidly and accurately distinguished.

The invention relates to a living body sampler and a drill applicable to the living body sampler. The living body sampler comprises a handheld drill gun, wherein a sampling insertion tube is mounted on a housing of the handheld drill gun; the handheld drill gun is provided with a rotating gun head; a sampling insertion rod is mounted on the rotating gun head and located in the sampling insertion tube; the sampling insertion rod and/or the sampling insertion tube are/is detachably connected with the handheld drill gun; a drill is arranged at the front end of the sampling insertion rod and comprises a drill shaft and at least one cutting blade arranged at the end part of the drill shaft; cutting edges of the cutting blades extend outwards from an axis of the drill shaft radially and achievecutting through the end faces of the cutting edges; the cutting edges of the cutting blades come out of the sampling insertion tube; and a sample storage cavity for accommodating tissue and organ samples is defined by the drill on the inner sides of the cutting blades, and the sampling insertion tube. The living body sampler achieves cutting and sampling through rotation of the adapted drill; thedrill can be clung to the surface of an organ for sampling; and therefore, injuries to the living body organ are reduced.

The invention discloses a central venous pressure measuring method and a related device applied to electronic equipment comprising a vein recognition module. The method comprises the steps of collecting pulsation image data of the neck right side vein through the vein recognition module; calling the pulsation image data processed through a motion amplification algorithm to obtain pulsation motioninformation; on the basis of the pulsation motion information, determining the central venous pressure. By applying the embodiment, the central venous pressure can be measured with no damage.