Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant human keratinocyte growth factor-1 and preparation and application methods thereof

A technology of recombinant cells and recombinant plasmids, applied in the field of genetic engineering, can solve problems such as differences in activity, and achieve the effects of simple preparation method, good market application prospect and good biological activity.

Inactive Publication Date: 2019-03-01
TEACHING HOSPITAL OF CHENGDU UNIV OF T C M
View PDF10 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether it is insect cells or Pichia pastoris, there are still activity differences between purified KGF and natural proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human keratinocyte growth factor-1 and preparation and application methods thereof
  • Recombinant human keratinocyte growth factor-1 and preparation and application methods thereof
  • Recombinant human keratinocyte growth factor-1 and preparation and application methods thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1 Preparation of recombinant protein of the present invention

[0025] 1. Construction of recombinant plasmids

[0026] (1) Synthesis of human keratinocyte growth factor-1 (KGF-1) gene

[0027] gene sequence analysis

[0028] The gene sequence of the KGF-1 coding region (GenBank:) was optimized to obtain the KGF-1 gene sequence (SEQ ID NO: 1) and the expressed amino acid sequence of the KGF-1 gene (SEQ ID NO: 2). Synthesized by Shanghai Sangon Bioengineering Co., Ltd., the synthetic gene sequence was recombined into the plasmid vector pUC57, and the plasmid containing the target gene was obtained as pUC57-KGF-1.

[0029] KGF-1 gene sequence (SEQ ID NO: 1):

[0030] AGCTATGACTACATGGAAGGAGGCGATATCAGAGTGAGAAGACTGTTCTGTCGGACACAGTGGTACCTGAGGATCGACAAGAGAGGCAAGGTGAAGGGCACCCAGGAGATGAAGAATAACTACAACATCATGGAAATCAGGACAGTGGCCGTCGGAATCGTGGCCATCAAAGGAGTGGAAAGTGAATTCTATCTCGCCATGAACAAGGAAGGAAAGCTCTATGCTAAGAAGGAGTGCAATGAAGATTGTAACTTCAAGGAACTCATTCTGGAAAACCATTACAACACATATGCCTC...

Embodiment 2

[0046] Example 2 Detection of biological activity of recombinant human KGF-1 (rhKGF-1) of the present invention

[0047] Take the recombinant human KGF-1 prepared in Example 1 and the commercially available KGF-1, and compare their biological activities:

[0048] 4MBr-5 rhesus macaque lung bronchial epithelial cells were cultured in F-12 medium, and then transferred to 96-well culture plate for further culture. Pre-diluted rhKGF-1 was added for 24 hours to make the final concentration in the range of 1-100ng / mL. The total volume was 100 μL, and the culture was continued for 48 hours in a 37°C constant temperature incubator. After the cultivation, add CCK8 solution, incubate at 37°C for 1.5h, set a multi-function detector to measure absorbance at 450nm, draw a graph and calculate EC50 (half effective concentration for stimulating cell proliferation).

[0049] The test results are shown in the table below. The present invention has the effect of obviously promoting the prolifer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a production of a recombinant human keratinocyte growth factor-1 (KGF-1) and discloses a recombinant plasmid of the gene of the recombinant human keratinocyte growth factor-1,a method of expression of keratinocyte growth factors after the recombinant plasmid is electro-transfected into Chinese hamster ovary (CHO), and purification processes of the recombinant plasmid. Therecombinant human keratinocyte growth factor-1 can significantly promote proliferation of 4MBr-5 cells and accordingly is applicable to treating skin and mucosal tissue damage-related diseases, lungdamage-related diseases and bladder and urothelium damage-related diseases.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to recombinant human keratinocyte growth factor-1 (rhKGF-1) and its preparation method and application. Background technique [0002] Human keratinocyte growth factor-1 (KGF-1 or KGF), also known as fibroblast growth factor-7 (FGF-7), is an important paracrine factor in the proliferation, migration and differentiation of human alveolar type II epithelial cells A cofactor that plays an important role by binding to the epithelial cell receptor KGFR. In bronchial epithelial cells cultured in vitro, KGF can accelerate epithelial cell healing, enhance the repair of airway epithelial cells and the mobilization and migration of circulating epithelial cells. KGF promotes the proliferation of airway epithelial cells and plays an important role in the detoxification of reactive oxygen species. In animal models, KGF reduced alveolar damage and mortality in rats, and also reduced the effect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/85C12N5/10C07K14/50C07K1/18A61K38/18A61P17/02A61P11/00A61P13/10A61P13/02
CPCA61K38/00A61P11/00A61P13/02A61P13/10A61P17/02C07K14/50
Inventor 高坪张培海
Owner TEACHING HOSPITAL OF CHENGDU UNIV OF T C M
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com