Fucosyllactose-producing recombinant expression plasmid vector, metabolic engineering bacteria and production method
A technology for expressing plasmids and expression vectors, which is applied in the fields of metabolic engineering and food fermentation, and can solve problems such as undiscovered, inhibited bacterial growth, substrate conversion rate, product yield, and limitations.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1: the construction of recombinant engineered bacterium producing 2'-fucosyllactosyl glutamicum
[0040] The gene encoding superoxide dismutase (Superoxide dismutase) existing in Corynebacterium glutamicum sod The promoter expresses each gene ( sod Promoter, gmd Gene, wxya Gene, lac Y Gene, f gene), expression can be achieved without the addition of an inducer. Using overlap extension PCR, the sod The promoter sequence is fused with the gene of interest to be expressed.
[0041] (1) Using the Corynebacterium glutamicum genome (NCBI accession number: GCA_000011325.1) as a template, design primers:
[0042] Upstream primer sod-gmdF1 (SEQ ID NO.10): AAAACTGCAGtagctgccaattattccggg
[0043] Downstream primer sodR (SEQ ID NO .11): GGGTAAAAAATCCTTTCGTAGG;
[0044] PCR amplification sod promoter sequence.
[0045] Using the Escherichia coli BL21 genome (accession number: GCA_000833145.1) as a template, design primers:
[0046] Upstream primer sod-g...
Embodiment 2
[0084] Example 2: Production of 2'-fucosyllactose by fermentation of recombinant Corynebacterium glutamicum CgdGYC shake flask with glucose as carbon source
[0085] (1) Seed medium: glucose 5.0g / L, nitrogen source and trace elements: 1.0 g / L yeast extract, 2.0 g / L NH 4 Cl, 10.0 g / L Na 2 HPO 4 ·7H 2 O, 3.0 g / L KH 2 PO 4 , 0.5 g / L NaCl, 0.25 g / L MgSO 4 ·7H 2 O, 15.0 mg / L CaCl 2 2H 2 O, 10 mg / L vitamin B1.
[0086] Fermentation medium: glucose 50.0g / L, nitrogen source and trace elements: 2.0 g / L yeast extract, 2.0 g / L NH 4 Cl, 10.0 g / L Na 2 HPO 4 ·7H 2 O, 3.0 g / L KH 2 PO 4 , 0.5 g / L NaCl, 0.25 g / L MgSO 4 ·7H 2 O, 15.0 mg / L CaCl 2 2H 2 O, 10 mg / L Vitamin B1, 0.1% (v / v) Triton-X 100.
[0087] (2) Pick a single colony of the recombinant strain Corynebacterium glutamicum CgdGYC in the seed solution with a liquid volume of 100mL, 30 o C, 180 r / min rotary shaker culture to OD 562 ≈10.0 as seed solution.
[0088] (3) Inoculate the seed solution of the recombinant ...
Embodiment 3
[0089] Embodiment 3: in the enhanced expression Corynebacterium glutamicum man A , man B with manC Gene expression enhances the production of 2'-fucosyllactose in recombinant Corynebacterium glutamicum
[0090] The phosphomannose isomerase gene required for the enhanced synthesis of 2'-fucosyllactose or 3-fucosyllactose involved in this example man A (The nucleotide sequences are respectively shown in SEQ ID NO.7), phosphomannose mutase gene man B (The nucleotide sequences thereof are respectively shown in SEQ ID NO.8) and mannose-1-phosphate guanine base transferase gene manC (Its nucleotide sequence is respectively shown in SEQ ID NO .9) is all in the genome of Corynebacterium glutamicum itself 。
[0091] (1) sod promoter sequence and man A Gene sequence acquisition: using the Corynebacterium glutamicum genome as a template, design the upstream primer sod-manAF1 (SEQ ID NO .23): TCCCCCGGGTAGCTGCCAATTATTCCGGG and the downstream primer sodR: GGGTAAAAAATCCTTTCGTA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


