Unlock instant, AI-driven research and patent intelligence for your innovation.

Reagent kit and method for detecting M.tuberculosis isoniazide drug tolerance mutation gene

A technology for Mycobacterium tuberculosis and drug-resistant mutations, applied in the biological field, can solve problems such as cumbersome operations, difficulty in achieving rapid clinical detection by linear hybridization, and long cycle times

Inactive Publication Date: 2020-02-14
DAAN GENE CO LTD
View PDF18 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Among the phenotypic detection methods, the traditional Roche medium drug susceptibility detection method and the BACTEC MGIT 960 system detection method are cumbersome to operate and the cycle is long; the DNA sequencing method in the molecular biology detection method is expensive and difficult to popularize, and it is difficult to implement the linear hybridization method. Meet the requirements of clinical rapid detection, and although the gene chip method has made some progress, there may be wrong nucleotides mixed in when synthesizing probes
And the operation process is complicated, the material is expensive, the cost is high, and it is also difficult to popularize

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent kit and method for detecting M.tuberculosis isoniazide drug tolerance mutation gene
  • Reagent kit and method for detecting M.tuberculosis isoniazide drug tolerance mutation gene
  • Reagent kit and method for detecting M.tuberculosis isoniazide drug tolerance mutation gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0119] 1. Design and synthesis of primers

[0120]By calling the whole genome sequence of Mycobacterium tuberculosis in GenBank, and targeting katG (GenBank Accession Number NC_000962, 2153889-2156111 nucleotides), inhA (GenBank Accession Number is NC_000962 1674202-1675011 nucleotides) aphC (GenBank Accession Number is NC_000962 No. 2726193-2726780 nucleic acid), primer design is carried out, and the specific amplification screened out is better, and the sequence suitable for the multiplex reaction system is as follows.

[0121] The katG primer sequence is as follows:

[0122] JH-katGF02: TCACACTTTCGGTAAGACCCAT (SEQ ID NO.: 1)

[0123] JH-katGR02: AGCTCCCACTCGTAGCCGTA (SEQ ID NO.: 2)

[0124] The primers for inhA are as follows:

[0125] JH-inhAF02: ACACCGACAAACGTCACGAG (SEQ ID NO.: 3)

[0126] JH-inhAR02: CCTCCGGTAACCAGGACTGA (SEQ ID NO.: 4)

[0127] The primers for aphC are as follows:

[0128] JH-aphCF02:GGTGTGATATATCACCTTT (SEQ ID NO.:5)

[0129] JH-aphCR02: CTCTCC...

Embodiment 2

[0175] Embodiment 2: National reference product detection experiment

[0176] 1. Detection of negative and positive reference products:

[0177] 1) Extraction of nucleic acid samples

[0178] All negative and positive national ginseng samples were extracted with a kit (Nucleic Acid Extraction or Purification Kit, Sun Yat-Sen University Daan Gene Co., Ltd., Yuesui Machinery No. 20170668) for nucleic acid extraction

[0179] Detection:

[0180] The wild-type and mutant plasmids were used as negative and positive reference materials respectively, and the national ginseng samples were tested

[0181] 2. Detection of the lowest detection limit sensitivity

[0182] 1) Sensitivity detection of drug resistance detection limit

[0183] Sensitivity reference samples come from a nominal concentration of 1×10 5 National reference substance of CFU / ml (National Institute for Food and Drug Control). According to the instructions of the national reference product of the Mycobacterium tu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a reagent kit and method for detecting an M.tuberculosis isoniazide drug tolerance mutation gene, particularly a multiplex PCR amplification system of three target genes katG, inhA and aphC with M.tuberculosis isoniazide drug tolerance mutation is established, and through a high-resolution melting curve method, wild types and different mutation types can be distinguished. Inaddition, through binding a molecular beacon probe, a multiple asymmetric PCR reaction can be realized, so that the mutation site of a tuberculosis resisting bacterial strain can be detected quicklyand accurately, and multiple sites can also be detected in a disposable manner.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular, the invention relates to a kit and a method for detecting the isoniazid resistance mutation gene of mycobacterium tuberculosis. Background technique [0002] Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis, which is characterized by a long incubation period and a high fatality rate. So far, it is still one of the three major infectious diseases that seriously endanger human health worldwide, along with AIDS and malaria. Mycobacterium tuberculosis, which belongs to a class of pathogenic bacteria in the genus Mycobacterium, is the pathogen of most tuberculosis. At present, about 30% of people in the world have been infected with tuberculosis, and the annual death toll is nearly 3 million. Therefore, tuberculosis has always been It is a global health problem that threatens human health. Since the 1940s and 1950s, Mycobacterium tuberculosis has also been effecti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6858C12N15/11C12Q1/04C12R1/32
CPCC12Q1/689C12Q1/6858C12Q2600/106C12Q2600/156C12Q2600/16C12Q2531/113C12Q2537/143C12Q2527/107C12Q2563/107
Inventor 蒋析文黄桃生陈香女玉小静林卫萍
Owner DAAN GENE CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More