Bioproduction of phenethyl alcohol, aldehyde, acid, amine, and related compounds

A technology of phenylethanol and phenylacetaldehyde, applied in biochemical equipment and methods, oxidoreductase, lyase, etc.

Pending Publication Date: 2020-02-21
NAT UNIV OF SINGAPORE
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods yielded only low to moderate concentrations of the desired product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bioproduction of phenethyl alcohol, aldehyde, acid, amine, and related compounds
  • Bioproduction of phenethyl alcohol, aldehyde, acid, amine, and related compounds
  • Bioproduction of phenethyl alcohol, aldehyde, acid, amine, and related compounds

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0162] Example 1. Genetic engineering of Escherichia coli containing module 2-1 and expressing SMO and SOI

[0163] The styC gene encoding the SOI (SEQ ID NO: 9) from Pseudomonas sp. VLB120 was first synthesized and codon-optimized for E. coli according to the published sequence. Primers StyC-KpnI-RBS-F (CGGGTACCTAAGGAGATATATAATGTTACACGCGTTTGAACG TA AAATG; SEQ ID NO: 29) and StyC-HindIII-XhoI-R (ACTGCTCGAGAAGCTTACTCGGCTGCCGCGTGTGGAACGGC TTTACG; SEQ ID NO: 30) and Phusion DNA polymerase (available from Thermo) were then used Amplify it. The PCR product was double-digested with KpnI and XhoI, and then ligated with the pRSF-SMO plasmid after the same digestion with T4 DNA ligase [Wu, S., Chen, Y., et al., ACS Catal.4:409- 420 (2014)]. The ligation product was transformed (heat shock) into E. coli T7 expression competent cells (available from New England Biolabs) to yield pRSF-SMO-SOI. This module 2-1 was subcloned into the other three vectors by the following procedure. The m...

Embodiment 2

[0164] Example 2. Genetic Engineering of Escherichia coli Containing Module 2-2 and Expressing SMO, SOI and PAR

[0165] First, the pad gene encoding ADH (alcohol dehydrogenase; SEQ ID NO: 11) from Saccharomyces cerevisiae was synthesized, and the codon optimization for Escherichia coli was performed according to the published sequence. It was then processed using primers PAR-HindIII-RBS-F (ACTGAAGCTTTAAGGAGATATATAATGAGCGTGACCGCGAAA ACCGTG; SEQ ID NO: 32) and PAR-XhoI-R (ACTGCTCGAGTCACATGCTTGAACTCCCG CCGAAA; SEQ ID NO: 33) and Phusion DNA polymerase (available from Thermo) Amplify. The PCR product was double digested with HindIII and XhoI, and then ligated with the same digested pRSF-SMO-SOI plasmid with T4 DNA ligase (see Example 1). The ligation product was transformed (heat shock) into E. coli T7 expression competent cells (available from New England Biolabs) to yield pRSF-SMO-SOI-PAR. This module 2-2 was subcloned into the other three vectors by the following procedure. ...

Embodiment 3

[0166] Example 3. Production of 2-PE from Sty via cascade biocatalysis by using E. coli containing module 2-2 and expressing SMO, SOI and PAR

[0167] The recombinant Escherichia coli (StyABC-PAR) containing the plasmid pRSF-SMO-SOI-PAR was grown at 37°C in 1 mL of LB medium containing 50 mg / L kanamycin, and then inoculated into 50 mL containing glucose (20 g / L L), yeast extract (6g / L) and 50mg / L kanamycin in the M9 medium. When OD 600 When 0.6 was reached, 0.5 mM IPTG was added to induce expression of the enzyme. Cells continued to grow and express protein for 12 hours at 22°C, after which they were harvested by centrifugation (4000 g, 10 min). Cells were resuspended in 200 mM KPB buffer (pH=8.0) with 2% glucose (for cofactor regeneration) to 10 gcdw / L. To 2 mL of the aqueous system, 2 mL of n-hexadecane containing 60 mM Sty was added to the reaction system to form a second phase. The reaction was carried out in a 100 mL flask at 30 °C and 300 rpm for 8 hours. During the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

This invention relates to the bioproduction of substituted or unsubstituted phenylacetaldehyde, 2-phenylethanol, phenylacetic acid or phenylethylamine by subjecting a starting material comprising glucose, L-phenylalanine, substituted L-phenylalanine, styrene or substituted styrene to a plurality of enzyme catalyzed chemical transformations in a one-pot reaction system, using recombinant microbialcells overexpressing the enzymes. To produce phenylacetaldehyde from styrene, the cells are modified to overexpress styrene monooxygenase (SMO) and styrene oxide isomerase (SOI). To produce phenylacetic acid from styrene, SMO, SOI and aldehyde dehydrogenase are overexpressed. Alternatively, to produce 2-phenylethanol, SMO, SOI and aldehyde reductase or alcohol dehydrogenase are overexpressed, while to produce phenylethylamine, SMO, SOI and transaminase are overexpressed.

Description

technical field [0001] The present invention relates to the bioproduction of useful and valuable phenylethyl alcohols, aldehydes, acids, amines and related compounds using novel biocatalysts. More particularly, the present invention provides methods for the biological production of substituted or unsubstituted phenylacetaldehyde, 2-phenylethyl alcohol, phenylacetic acid, or phenylethylamine by one or more recombinant microbial cells that have been genetically engineered To overexpress at least one enzyme relative to wild-type cells, the method comprising subjecting a starting material to chemical conversions catalyzed by multiple enzymes in a one-pot reaction system, wherein the starting material is selected from the group consisting of glucose, L-phenylalanine, Acid or substituted L-phenylalanine, styrene or group of substituted styrenes. Background technique [0002] 2-phenylethanol (2-PE), phenylacetaldehyde (PA), phenylacetic acid (PAA) and phenylethylamine (PEA) are wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/52C12P7/24C12P7/54C12P7/22C12P13/00
CPCC12N15/52C12P7/22C12P7/24C12P7/54C12Y503/99007C12Y114/14011C12P13/22C12N9/0006C12N9/0008C12N9/0071C12N9/1085C12N9/1096C12N9/1205C12N9/88C12N9/90C12P13/001C12Y101/01001C12Y101/01282C12Y102/01003C12Y205/01054C12Y206/01057C12Y207/01071C12Y402/01051
Inventor李智吴淑可周颐本尼迪克特·瑞恩·鲁克托
OwnerNAT UNIV OF SINGAPORE