Solanaceous plant resistant to virus of genus begomovirus causing tomato yellow leaf curl symptoms, solanaceous plant cell, and method for producing solanaceous plant
A plant and nightshade technology, applied in the field of nightshade plants, can solve problems such as inability to prevent TYLCV infection itself
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0266] Production of recombinant Agrobacterium A for introducing mutations into the eIF4 gene
[0267] In exon 2 (SEQ ID NO: 2) of the eIF4E gene (Solyc03g005870) thought to be present on tomato chromosome 3, sites recognized by guide RNAs were arbitrarily set. A double-stranded DNA corresponding to the designated 20-base-long site (SEQ ID NO: 3: AGGGTAAATCTGATACCAGC) was synthesized and inserted into the vector pUC19_AtU6oligo (obtained from the National Institute of Agricultural Bioresources, National Research and Development Corporation). The restriction enzyme BbsI site was used to construct the recombinant vector A. It should be noted that the cDNA sequence of the eIF4E gene present on chromosome 3 of tomato in the wild strain is shown in figure 1 and serial number 1.
[0268] The gene cassette site containing the guide RNA sequence region was cut out from the constructed recombinant vector A, and inserted into the restriction enzyme I-SceI site in the binary vector pZ...
Embodiment 2
[0270] Production of recombinant Agrobacterium B for introducing mutations into RLK gene
[0271] In exon 1 (SEQ ID NO: 5) of the RLK gene (Solyc02g091840) thought to exist on chromosome 2 of tomato, sites recognized by the guide RNA were arbitrarily set. A double-stranded DNA corresponding to the designated 20-base site (SEQ ID NO: TCTCTAGAGTACCTTGCAGT) was synthesized and inserted into the vector pUC19_AtU6oligo (obtained from the National Institute of Agricultural Bioresources, National Research and Development Corporation). The restriction enzyme BbsI site was used to construct the recombinant vector B. It should be noted that the cDNA sequence of the RLK gene present on chromosome 2 of tomato in the wild strain is shown in figure 2 and serial number 4.
[0272] The gene cassette site containing the guide RNA sequence region was cut out from the constructed recombinant vector B, and inserted into the restriction enzyme I-SceI site in the binary vector pZD_OsU3gYSA_Holge...
Embodiment 3
[0274] Production of recombinant Agrobacterium C for introducing mutations into the deltaCOP gene of chromosome 1
[0275] In exon 6 (SEQ ID NO: 34) of the deltaCOP gene (Solyc01g103480) thought to be present on chromosome 1 of tomato, sites recognized by guide RNAs were arbitrarily set. A double-stranded DNA corresponding to the designated 20-base-long site (SEQ ID NO: 35: ACTGGCTTTGGCAGCGACTC) was synthesized and inserted into the vector pUC19_AtU6oligo (obtained from the National Institute of Agricultural Bioresources, National Research and Development Corporation). The restriction enzyme BbsI site was used to construct the recombinant vector C. It should be noted that the cDNA sequence of the deltaCOP gene present on chromosome 1 of tomato in the wild strain is shown in Figure 13 and serial number 33.
[0276] The gene cassette site containing the guide RNA sequence region was cut out from the constructed recombinant vector C, and inserted into the restriction enzyme I-...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More