Solanaceae plant with tomato spotted wilt virus resistance, solanaceae plant cell and preparation method of solanaceae plant
A technology of tomato spotted wilt virus and production method, which is applied in the fields of botanical equipment and methods, angiosperms/flowering plants, biochemical equipment and methods, etc., and can solve the problems of difficult commercial cultivation of transgenic plants and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0189] Production of recombinant Agrobacterium for introducing mutation into RLK gene
[0190] In exon 1 (SEQ ID NO: 2) of the RLK gene (Solyc02g091840) thought to be present on chromosome 2 of tomato, a site recognized by the guide RNA was arbitrarily set. A double-stranded DNA corresponding to the set 20-base long site (SEQ ID NO: 3: TCTCTAGAGTACCTTGCAGT) was synthesized, and a restriction enzyme inserted into the vector pUC19_AtU6oligo (obtained from the National Institute of Agricultural Bioresources) BbsI site, the recombinant vector was constructed. In addition, the cDNA sequence of the RLK gene present in the chromosome 2 of the wild-type tomato is as follows: figure 1 and serial number 1.
[0191] The gene cassette site containing the guide RNA sequence region was cut out from the constructed recombinant vector and inserted into the restriction enzyme I-SceI site in the binary vector pZD_OsU3gYSA_HolgerCas9_NPTII to obtain the recombinant binary vector. Using this b...
Embodiment 2
[0193] · Tomato transformation
[0194] As the tomato to be transformed, Moneymaker or our company's variety S, which is a well-known variety, was used. According to general textbooks (for example, Itoyo Tabe, "Protocols for plant transformation" ("Protocols for plant transformation"), Chemical Doujinsha Co., Ltd., 2012) According to the described method, transformation of tomato using Agrobacterium was carried out. Specifically, the cut pieces of the cotyledons obtained by germinating tomato seeds in a sterile medium, or the cut pieces of the cotyledons or the cut pieces of the true leaves that are usually sown were prepared. Sterilized leaves. Next, a culture solution was prepared by culturing the recombinant Agrobacterium obtained in Example 1 to a culture solution with a turbidity of 0.1 to 1.0, and immersing the leaves in the culture solution for about 10 minutes to make them infected with Agrobacterium.
[0195] Agrobacterium was removed after 3 days from infection. ...
Embodiment 3
[0199] Choice of gene editing system
[0200] To confirm the presence or absence of gene recombination and editing (deletion, insertion or substitution of bases) sites within the target genes of the current generation of the transgene, the target sites were amplified by PCR using the following primers:
[0201] For the region within RLK (Solyc02g091840), primer 1 (TTAACACGTCTGCGTAACCTC, SEQ ID NO: 4) and primer 2 (CCGGTGAAGGTATTGTAGTATCC, SEQ ID NO: 5) were used.
[0202] For PCR, "KOD Plus Neo" manufactured by Toyobo Co., Ltd. was used, and DNA amplification was performed according to the instruction manual attached thereto.
[0203] Next, the amplified fragment was treated with a restriction enzyme having a restriction enzyme cleavage site in the target site, specifically, XbaI, and it was confirmed whether or not the amplified fragment was cleaved. In the gene that has undergone genetic recombination and editing, the amplified fragment will not be cleaved by the restriction ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More